ZFIN ID: ZDB-ALT-110630-22
Genomic Feature: hu1968
Synonyms: Y260 (1)
Affected Genomic Regions: stk11 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Clevers Lab
Location: Chr 2: 59052212 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CAGAATTCAGATCAGATTCAGCACAGTGTTCAGATCAATGCAGTTGATCTTTATTTGTACAGCACTTTTACAATGTAGATTGTGTCAAAGCAGTTTCAGATAATGGATCATGGTTGCTGGAACACCTTTACCCTGTAGAAGATTGTTAGAGAAGCTAGAGTAGACTGCTTATTTTTCAGACGCGCTGGGCGGAGTCGCACTGTTAGGACCGCCCATTTTTTTCAGAAGCGCTGATTATTTGTGGTTTGCAAATGTTTGTTTTAAATAAAAATGTATTGATATGTTTATTTATTATGTAAGATTTTTCTTCTATCAGTCACATATACATGATAAATATCTATATAAAATACACACATATATTATGTCAACTTTTATTTTGGATGCGATTTATCTTTGCACTAGTTTTCACAGATATGTAAATAAATAAATAATTAAAGTGTGTCCGCTCACAGATACAACATCACCACGAGCCTGTACCCGTTTGAGGGAGACAACATCTA
T/G
AAGCTATTTGAAAACATTGGGAAAGGAGATTACAGCATCCCGGAGGAGTGCGGCCCGCTGCTCTCAGACCTGCTGAGGGGTAAATATACCACATTTACTCTCTCTTTAAGGGGCAGTTCACACACACATCTACCTTCTGACAATATTTCCTGAGTTTCCTCTGCTGAACACAAAGGAACCTATAGTGACGCATGCTGGACAATATAATCATAGCCTTTCTGCTCTTCCTTTGGCTCTGAATGCATTTTAAATGAACATTGAATTTTGCTTTAATCGTCTTGAATGAGCGTAAATAACATTGAAATGATCATTTTGCGTCAGTTTTACATGCTTTAATTCAATCCGGGTATTTCATTTTCAATTTAATTTTGACACCTTTTAAATCATTACAATTAGTAGGTGATTTTACACGTTAAAAGGGTTTACAGGTTGTAAACTGCAAATGTAAATTATATTATTACTGTGGTGGTGGTTGTTTTTAAAAGTATCTTCTATTGCTA
Comment Citation
A T-to-G substitution leads to a premature stop codon in the kinase domain. ZFIN Staff
OTHER hu1968 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous stk11hu1968/hu1968 stk11 ♀+/- ♂+/-
Complex stk11hu1968/hu1968; vhlhu2117/hu2117 stk11, vhl
Unknown stk11hu1968 stk11 Unknown

CITATIONS  (5)