Genomic Feature

nl2

ID
ZDB-ALT-110523-4
Name
nl2
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
adult males treated with ENU
Lab of Origin
Nechiporuk Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 1: 49885453 - 49885454 (GRCz11) (1) Details
Nucleotide change
-/G
Variant Notes
The mutation is a single guanine insertion at position 1120. The resulting  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp inserted at position 1120 (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Elongated Polypeptide: 29 AA added (1)
Sequences
Flanking Sequence
AATTTAATTTACTTGCTTGATTATATTTAAATGTTTATATATTTTATTATATTTTTATTTTATGTTTATATATTTTAATATATTTTCTATTTTTTATTTTACTTGTTTGATTTTATTTAAATGTTTATAAAATTTTATTTATATTTTTTTAAATTAATTTTACTCGCTTGATTATATTTAAATGTTTATATATTTTAATAATTTTACTTGATTATATTTAAATATTAATATATTTTAACATATTTTTATTTTATGTTTATATATTTTCATATATTTTTTATTTTATTTATTTGTTTGATTTTATTGAAATGTTTTTATATTTTATTTGATTTCATTTAAATGTTTACAAAACTTAATTGACGTAATTTTGTTTTATTTTACTTAAACTTTTTGTATTTTGTTGTAACTTTAGTTTAGTGTTGAGTAATGTATTATTTATTTTATTTTAATAGTTTTTTAAAGACCCTCAATATTCATCATTTGTTTTTTTTATAGGGAAAG
-/G AAAAAAAAGCGGAAGAGGGAAAAGATCCAGGAACCTGCTTCAGGTGAGACTCAATAACCTTCTATCCATGCTGATATTTGTGCAGTTTTGTTAATACATGCTCTAAATAAGCTCCATGTCACTTACTTTGCAACTAATGTGGTTAATGATGGGGTTTCGCATCCTCAATATGCACTTTCAGCCAACTTCAATCACAAACTGATGAAGATGAACATTCATTTAAGACTTTGTTTGTTGCCTAAAAATTAAGTTCTGTACATACTTTTCATTTGCATATACATTATGAACAGAGCATCCCACCACTCCATCTTTCATCCTCTCACAATTCAGTCTTTAGGATTAGTCTGTTTAAAAATAAAAATAAAAGCCTCCACATGCTTCCTTCAGTGCTTTCTGCTCTTTTATAAACGCATTAGCAATGTATGCTTAACACTTCAATGTTTGTCTGGCACTAAATCTAGATGATATCATTAAAACTTGTGTATAATGTAAAAGTTAAAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations