Genomic Feature

mw1

ID
ZDB-ALT-110211-1
Name
mw1
Synonyms
  • bugeye (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Link Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 9: 48455913 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
T to A conversion that changes a cysteine to a stop codon at amino acid  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
GTTTGGACTGTGGGGGAAACCGGAGCACCTGGAGGAAACCCACGCCAACATGGAGAGAACATGCAAACTCCACACAGAAACACCAACTTGCTCAGTCGGGACTCAAATCAGCGTCCTTCTTGCCTTTAGGCGACAGTGCTAACCACTGAGCCACCCTGCCACCCAGCTCTTTATATTCATTCATTTTCTTTTCGGCTTAGTCCCTTTATTAATCAGGGGTCACCAATGTGGAATGAACCGCCAAATTATCCAGCATATGTTTTATGCCCTTCCAGCTGCAACCTATTACTGGAAAACACCCATACACACTCATTCACACACATACACTACGACCAATTTTGCTTACCCAATTCAGCTCTGTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTTGTGTAGAACATGTCATCAGATTATCGTTATTTTCTGTCTAGGTTCAGGTTG
T/A GAGTCGGGATTTTTCCGTTGCGGGACGGGCCGGTGTATTCCAGTCAGTCAGAGATGCGATGGGACAAACGACTGTTCGGATAACTCAGATGAAATTGGCTGCCGTATGTATCAATCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCCTTTCTTTTCTTCACAGTTTCTTACAACAAGGGCACACTGGATACTGCATGCCAGGGGCACAATTGCACATTTACTGAGGATTATGTGGGTTCAAGTTTTTTTTTCATTTTTTATTTTGCGCTCCACGTCTCTTGATTTTTCTTTCTATTTTGAACATGTAACTGTAACCGATCAACGAAATAATATCCAGGTGCAACAGATCAAATGGTCAGCGGAGGGGGAGGGGTGGTATAATTTTATATTTAATAAAATACAATAATATATCCATATAAAATGCAAAATAAACATTTTCGACAAAAATTATTTATTTCTTTTTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations