header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-100506-15
Genomic Feature: sa115
Synonyms: sa0115 (1)
Affected Genomic Regions: otpb (2)
Type: Small Deletion (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 51618607 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 1 bp deleted (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: at position 96 (1)
FLANKING SEQUENCE
CTGTTTCTGTTGGTTTTGCTGGCCGCCCGTCTGATTGGAGTTTTGCTGTT
G/A
CTGCTTTTCTTGGTCTTTGGCGTTGACCTGCTGCATTCCATTAGGATTGG
(1)
NOTES
Comment Citation
Fernandes (2013) The otpbsa115 allele carries a base-pair deletion at amino  ... Fernandes et al., 2013
OTHER sa115 PAGES
ZMP:sa115 (1)

CITATIONS  (10)