Genomic Feature

hu4602

ID
ZDB-ALT-100205-1
Name
hu4602
Synonyms
  • expando (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Schulte-Merker
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 14: 15834991 (GRCz11) (1) Details
Nucleotide change
A/C
Variant Notes
The point mutation is predicted to change a conserved isoleucine residue into a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Ile>Ser at position 1042 (1)
Sequences
Flanking Sequence
TCTTTGTCATGATGACAGTACATTTTACTAGTTATTTTACAAGATAAAGTGCAACTTAATCTGATAAAGTGCAACTTAAATGCTTAACTAGGTTAATTGTGTTAAGTCGGGAAGTTATGTCAAACAAACAAAAAAACTTTCTCCAGAAGAAAATATTATAGGAAATACTGTGGAAAGTATCCTTGCTCTGCTTAACAAATATCTGCAAAAAATTTACATTTCCCAGGAGGGTTAATAATTTAGTCTTCAACTTTTTAGCACCTTTTTAAAACTCTTGCAAAATCTTAACAGTTCCTGTGAGATTCACCCAGATATTATTCTTTAGAGATCTTTGTTGATCTTGATAGTGTTTTTTAGTAGAAGGTATAAGGGTTCCTCTTACATTGCCTTTGCGCACATAGTCAGGGTCTTTGTAGATGTCCCGTGCTAAACCAAAGTCACAGATCTTCACCACATTGTTCTCGGACAGGAGGATGTTTCGGGCTGCCAGATCTCGATGA
A/C TACACTGAAATACATACAGAAATCAAGATCATTTCAGAAAATATCTGTATGTACAGTTCTCAGCATATATAAGTACACCCCTCGCAAATCTATCTTTCAAATTCATATATTTATTAGAAGCTATCCAATTTTATATTTGTGCAAATGCATTAGATCAGTCAGTACTAAAGCCAAATCAAGAGCTTATCTAACAAAATAACTAACAAAAATGGTCCAAAAACCAGTACACCCAAATTTATATCTTTTTTTAAATATTAAATACAAATTAAAAAACAGGAAAAATCAAGAAAAGCAAAAAAAAAAATAATAATAAAATAAATGAGCTGAAATTTTGTAGGTTGTAAATTATTCTTGCAATATTCTGCTTGAATTTAATTGTATCTTGAATCTTTCAATTTCTAAATATGTTTGCTGACTAAAATATTATTTAAATGAATATATCTGTTAAATAATTTTTTTTTGTTTAAATGCATCAACATACATTGCCTATATTCACTGAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations