ZFIN ID: ZDB-ALT-081111-1
Genomic Feature: t26458
Synonyms: IL256 (1), IL256AA (1)
Affected Genomic Regions: krit1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 19: 46010385 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 237 (1)
FLANKING SEQUENCE (GENOMIC)
ATCATGACAAAGAGAAAAGAAATCAGTTATTAGAGATGAGTTATTAAAACTATTATGATTAGAAATGTGTTGAAGAAATCTGCTCTCCATTAAACAGTCATTGTTTCTGTATAATATATATATATATATATATATATATAATGAATTAGGGATGCTTATTTTTTGTTAATTTTCCCAATCGACAACCATTGCTCCTTGAACCAAATATTACCCGTCAACCGATCAGATTAATATTAAATTATCATTTAATAAAAAAATTAATTGGTGCGTCTATTTAGTGACTGACACATTAAATATTACATTTTAAAATATTGATTCATTTTAACATGCAAACAACAGCACACAGCATGTTCTACACATGTTAACAACAGAACCCAAATAGTCTGAATGGTATCCTGCTGAATTATGAACAGTATAATCTATGGACGCAATGCAGGAGATATTTATTTTGTCATGATTTTTTTATTTATATTGATGAAAGCGAGCCTCACTCTGTTGGT
G/T
TACTGCAGATCTGAGCCGTACAGCGGGTTCTGGATGCACAGATCTGCTTTCTCCAGAGACATCAGTTTACTCTTGATCTCCAGAGCCGTGTAGCCCATGTGCAGCGTCCCGTCTGTCTGCTTCTCCACTGCGTACGCCGGGTTACTCACGTTAGTTTTCACACGGTCCACCGGAGCCGGCCGGAACAGAGCAGGAATAGCGTGAGGCACAGTGTGCTGCTCCGCTAACCACCTGATACACACAGAGACAATAATACACTGAGTAACCCTTGAGTATTGCTCAAACTGACTACATTTACGTTACGCTTGTGGCTGTTTTTGCCTCATTGACTTCCTTTATAAGGACATCTTTGAGTCTTGACAGCATATAATCATGCATTCTTGATTGTTGCTAGTTTTTCCCTGTTGGGAAGAGGTCAAATTTGTTATTTGTACTGTCGATCTGTAAATCACAGGCTGTTATTGGTGATACCGACACTGAAACTTTGTGCAAATACACCT
Comment Citation
Cytosine to adenosine transversion mutating a tyrosine into a premature stop  ... ZFIN Staff
OTHER t26458 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous krit1t26458/t26458 krit1 ♀+/- ♂+/-
Complex krit1t26458/t26458; ccm2hi296aTg/hi296aTg ccm2, krit1
krit1t26458/t26458; s843Tg krit1
krit1t26458/t26458; y1Tg krit1
krit1t26458/t26458; y7Tg krit1

CITATIONS  (5)