Genomic Feature

hu3536

ID
ZDB-ALT-080819-3
Name
hu3536
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Hubrecht Institute
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 12: 27558682 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
CAGATTTTGTGGTGTTATGATGCACACATTTTGGCACGCAATTCATTTAAAGTCTAAAATCATTTTCATTTGTTAAACAAAAATATGTTGGGCACAAGGATGCTCACTTCCCATTAGATTTTAGGTCAATTTTAATTAAGCATGTTCCTATTTTAAGAAAGTAAGTCTGGAACAAGTGTAAAAATAGTCAAATCTATTCATATGCTTTCCGGTTTTTAACCTTCATATGAACAGATAAAAATACAAATAATTTAACTGTTATTAAACAATCTTGCCCTGATATGCAGTGTTTGCAGTCCAAAAAGCATCCACACATGCTCTACAACTGTAAAATAAAACATATTGTTGACTTGAAAGTGTTTGTGTGCCCTGCAGTGCCTATGAGCAGAAGAGAGCAGCCGTGGCAGGAGCAGGAGGATCTAAGAGCTCATGTCCAGGGACGCCCATGTCCCCTATGCAGCATTATTCCCCCAAACCAACAGTGGGAACTCGGCAGGAAT
C/A AGGGTATATGAATCCACCCTCAGCCAGCCAATCCCACGCCTGCCACAGCCACAGTTACCCCATGAACCCCAGGTAACAATAAAAATAAAGAATGTGTAGTTGTGTGTAGTTTTGACTTGGAAAGCATGTGTAATTCGACCAAAACTATCGTTTTAACAAGACATTACTCTTAGCTAAAACAAAAATTTTTGGACAAAAAGCTAATTAAATACAACATATTCTGGACAAAAATGATTCACAGCTTAAAGAGGTGGTCCACTTCCACATCATATTTTAAACTTTAGTTGATGTGTAATGTAGCTATGTGAACATAAACAACATCTCTGAATCTAAGACGCATAAAGTTCAATGCAAAGGAAGGCTTTTACAGAGTTAGCTTAGCAATACAGCAACCGAAGTTTGGGGACTACAAAAAAATACATCCGGGTTAATGATGTCATAAACCCTTCAGGTTATGCACATACACCCAGCTCAATGAAGGGGCATAGCCAGAGGCACTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations