Genomic Feature

sa73

ID
ZDB-ALT-080610-1
Name
sa73
Synonyms
  • sa0073 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Stemple Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 19: 28258956 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TTTACATAATAGCATAGTTAAGCCTTTAAATTGCACTTTAAGCTTAATGCTAGTATCTTGGAAAATAAATAGAAAAATATTATGCACTGTCACTATAGCAATGGCAAAAGAAATTAGTCATTATTAGTTAGTTATTAAAAGTATTATGTTGAAAAATGTTTGTTCAATGTGTTTGTCTTTATTAAACAATATCTGAAAATATTTTAAATTTAATTTTGACTTTAACTGTATATGTATGTGGGTATTTTTATACCTAATAAATATACACAGTACACATAAATTAATGGTTAATCACGTTGAATCATTTGGCAGTAGTTCATGTCACAATTAAAGTAATATATCTATAAAATTTCCACTCAATGATGTACATACCTTGCTTTATTTTATGCTTTATATTAGGGTAAACTCAATGAGAAAGATGGAGTGCAAACTGGACATTCAAGAGTTACCCAAAGCTCTGCATATTATCCCTACGACTACCCAATTGGACAATACTCATA
T/A GATCGATATGGGTAAGAACTGCAACCTTTTTTTTTTATTTTTTTTTTACATTTTTGGCTTTAATGATAGTATAAAAAGTTGTATTTGAGCATTTTCCATGTTGTTTAGATATGGATCTGTAGATGTGGGGACAAGAAGAAAGAATGCCACCAGAGAGACCACCAGCACATTGAAAGCATGGTTGCAGGAACATAAAAAGAATCCGTATCCTACAAAGGGTGAGAAGATCATGTTGGCTATCATCACTAAGATGACCCTTACGCAGGTCTCCACCTGGTTTGCCAACGCACGCCGGAGACTCAAGAAGGAGAATAAGATGACGTGGTCACCACGTAACAAGAACTCAGATGAGAAGGAGTGTGACGACGACCAAGAAGATCTGGATGAAGCGCAGGAGGAGCCAATAAAAACTGAACAAGATTTCAATGGTTTGTTCAAAGATTTTTTTATCAGTTTGGTTTAAAATGCAAATATCATTCCTTTAGCCTAGTCAGCATAGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations