Genomic Feature

gl8

ID
ZDB-ALT-070117-12
Name
gl8
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Lieschke Laboratory
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 7780718 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AGAGAATAAACACTCATCTAACCTCATTTCCAATGTCTGAAATGTTGATGCCACCATCACCTGGAAGGTCAAACACCAAATCACAGGTGAACTAAACCATGGTCACCGTACCATGATATATGCAATACTTTATATGTGCCTTTACCACCAAAATTAGGTACTCTACAAGCACATATAAAGCAATCAGGAAGTTTAGGCTGAGATTTATGTACAAGCAGAAGGTTTACGTTTAAGCATCCCCAGAAGATTTATGTATAAGCATGCAGCAGTTAAAAGGTACTGTATGATGTCTCACCAGTCTCTTTCCAAGGCTCGAGATCAAAAGCTGGGATATTCCCACAGTTAACAAAATTGGCAGGACTCCGGAAGCGAAAAGGATCTCTGGGAACTTTAAGGATTCCGGTGTTGTCGCAGATTATGCGGGCCAGCGACACAGAGGCCAGAGCTGTTTTCTGTTTGGTGGTGAACACTCCATTGCTCTCAAACCACAACCTAAACAC
A/T AAGCAAGACTTGGCATTAACACCTCTCCAAGACAACTAAATATTTTTCACAAACTTCATTAGGGTGTCCTGACTTCCTACTGCAGTGTCTTGCAGAGTTTAACTCTTAACATGACCCAGCACAGGCGGTGCGGCGGAGCAGTGAGTAGCAAGAAGCCTCGCAGCACTGGTTCGAGCCTCGGCTGGGTCAGTTGGCATTTCTCTGTGGAGTTTGCATGTTTTCCCTTTGTTCAGGTGAGTTTCCACCGCTTTCCCGGTTTCTCCCACAAGTCCAAAGACATGTGCTATAAGCTAAATTGGCCGTAGTGTATGTGTGTGTGAATGAGAATGTATGGGGGTTTCCCAGTGATGGGTTGCAGCTGGAAGGGCATTCGCTGTGTAAAACATATGCTAAATAAGTTGGCACTGTGGCGACCTCTGATTAATAAAGAGAGTAAGCCGAAAAAAAAAAAATTATGAATGACCCAGCACATCTGATGAACTTTCTTAAAGACTTTGATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations