Genomic Feature

c144

ID
ZDB-ALT-070117-1
Name
c144
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Halpern Lab
Current Source
Other Pages
Note
The third position of codon 245 was changed from T to A, generating a stop codon within the T-box (Snelson et al. 2008, ZDB-PUB-080414-4).
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 15: 27367533 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
The third position of codon 245 was changed from T to A, generating a stop  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
CATGCATGGCATAACCATTTGATATTTGTACAGTAAAATAGAAATTTAATAAATGTATATTATCTGCTCATCACCTTTTTACTTAATCCGTACAATTAAGTAACTCTTATTAGATTTCTTCTTGAGATTTAATTTAATGTTATATTGAAAGCGCCACAAAATTAGTCGTGTTGCATGTCCGCATGACTGGTTTGTTTCTTTCCACCGGCATAGGCCTGCAGCTCTGTGATTTAACCCAAGAACAATATTTCCACTATTAATTAATATATAATGCGGTTTTATCGTCTAAAACTATTTTAAAGAGTAATGACTTGAAATGTATAATTATTGTGACGAGCACTAATGTCTTCCTCTCCTTCTTAACAGACCATCCTGAATTCAATGCATAAATATCAGCCCAGGTTCCATATTGTGAGAGCCAACGATATTCTGAAGCTTCCGTACAGCACTTTCAGGACATACGTTTTCCCTGAGACCGATTTTATTGCTGTCACTGCTTA
T/A CAAAACGACAAGGTATGTACCCATATTTTGGTAAATTAAAGCGATTTATTAGACATTACAGACATGTGCTTGCATATCTAAATAATGCACAACTTGACTATTCGTAATTTGTGCATATCTACTTTCGTTCTGCGATGCTTTTTGCATGCGATCTACGAGCCTGTACATTTGGTGGGATTTACTGTTTGTCCCTTGGTATAAAAAAGTAGCATAAGTGACAGTATTTTGAATATATGGATGTTAAATTTTATCTTGAAAATTGTTCAAATTCCTCACGTGTCCAGTGCTACTTTCAGCTACTGCTCATGTTAATTGTCGTCTGTGTCCGAGGGGCCTGGTGAGCTTGTCGGTATCGTAAAGTTTATGACATAGAGTCACAATCGATTAGCAGGCACTTAAGCTCGTCGGTTTGTCCGGGAGCAACACACACTGAGGCACAGCAATCAAAGCGTGTCAGTTTCTAAACGCAAAAAGCAGAGGCCATCTAGCTTAGCAATCTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations