Genomic Feature

s457

ID
ZDB-ALT-050919-86
Name
s457
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 68878145 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
Kalogirou et al (2014): point mutation (T to A transversion) in the ATG  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Start Loss (1)
Protein Consequence
None
Sequences
Flanking Sequence
AAATCCGTTCAATAAAGTTACACACTAAGAGTTTTACAAAGAAACACTGTTATTTATACAGACTTTTAGATTATTATGATCAAATCCGTTCAATAAAGTTACACATAAGAGTTTTACAAAGAAACACTGTTATTTTACAGACTTTTAGATTATTATGATCAAATCCGTTCAATAAAGTTACACACTAAGAGTTTTACAAAGAAACACTGTTATTTTACAGACTTTTCCTATGGTTGAACTTTTGGGTGGGCCGAAATCAAAGGATGTGTGAGAGTGTCTGGCCTCGCGCGAATAAACGCCTGCACTGTTTCCAGCAGCAGTGAACTTGACAGCTCTGCTCTCTGATGTGCCTGACGGATCAGAGGGATTCCCGGGACACTGCAGGATGGCAGGGGTCATCAGGGGCCAGATGCACACTTTAAAAGCACTGCCCAAACCAGGACACCCTCAGACGAGACACGGTCGGACGCGAGAAAGAATCCAAACCTCTCCATTCGCAA
T/A GCAGCCGGTCATAGCGTGCGCTTCATTCGCGTTATTTGTTTTACGCGTTGTTGATTGCGTGTGGATCGATAAAAATGGCGCGTTTATTAAAGATCATCGCACAGCTTTCTTCGGTGCTTACTCCAGCCAGTTTTATCCAAGGTACCCGCTGTACATGATGCAGTTATACAGAGACTTCAGCGGGAATAAGATGCTGACTACTCCTGCTAGTGTTGACAACCCGGCTCTCCATCAGTCTGACTTCGTCCTGAGCTTGATTGCACAAGGTAAGCATGCACCTGATTGTTACTTTGCACCTTATGCAAAGTTGTTACATGATCCGGTAACACTTTACAATAATAGTACATGAATAATGATGTATTAATATAAGCAATACATTATAATAAATGAACGATATGTGTAAATCAAGCGCTAATCATGAACTAACTTTAATGAGTCTCAAGAGTCCTTGTGTGGATGAGGCTTCCTTGTAAACTTGTTAGGGCTATTACATGATTTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations