ZFIN ID: ZDB-ALT-050324-2
Genomic Feature: rw716
Synonyms:
Affected Genomic Regions: cyp26a1
Type: Point Mutation (1)
Protocol: sperm treated with ENU
Lab Of Origin: Okamoto Lab
Location: Chr 12: 8956639 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T at position 814 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Glu>Stop at position 272 (1)
FLANKING SEQUENCE (GENOMIC)
GAAGTTCAACTTACATTCAATTCAAAGGTTTTGAGTGCGACTCTGAATCCTCCAGGAACAGGAGGGTTGATTCTGAGAGTTTCTTTAATCACACATCCAGTGTACTTCAGCTGGTCCAACAGCTCCATGCTCAAGCCTTTTCCCGGTGTATACATGCCCATTTCAACCTGTCAATGCAAATTTAACATTAGCCCTGGCCCTGATTGAGTAACATCATCAAACTCAGAATGAAACTTCTTAGATCTTACCTTCTCCTGAACCTCCTCTCTGACCTTCTGCACCACTTCTGTGTTCAGACCCAGAAACATGACTAGTGAGGTTGCAGTACTGGCGGTGGTTTCATGACCTCCAAATAGAAGCTCTGTAGCTGCTTCTTTCATCGCCTAAGCAATACGAAACATCACATTAGCACTGAATCGTACTTTTTGTGGGGCACAGAATAATATAAAAATAATACACTACCTGCAAACTAAAAGGTTCGTCACTTCTTCTGCTGTTCT
C/A
GATCAACAGCTGAAGAGCGTCTTTGTATTTCTGCTCGTTTTCATTGTCGTCATCTTGAATTTTCTTCCTGATGTTTTCCTCAATTTTAGAGTGAATGAAATTGCGTGCCCTCAAACCCTGCCGATCAAAAATCACACAAGTTGAGTTTAAGAGTATCGCATATTGAGAATGCATCTTCAGACATTTGTTCTGAGTAACTCACCCTGTACAGACCACTGAAAGGAACGTCGATTGGCAAGGAGAACAAGTTTTTGATCATTTCCTCAAAAGCTTCCACCAGTTCTTGCTCGTCCGTCTTTATTTGCTCTGGTTCAAAACCAAGCAGGATTCTCATAGCTATCCGAAACATGAGTTTCTTCATTTCTGGATAAACCAGCACGCAGGAGTCTTTTTGCAGCCATTCCTGTATGGCGCTCTTCACCTCCTGCTGGATCACGGGAATGTAGTGCTCCAGAGCATCTCGAGAGAACGCCCTCATAATGGCCTAAAACAGAAGAAGA
OTHER rw716 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cyp26a1rw716/rw716 cyp26a1 ♀+/- ♂+/-
cyp26a1rw716/rw716 cyp26a1 Unknown

CITATIONS  (16)