Genomic Feature

b700

ID
ZDB-ALT-040701-2
Name
b700
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
ENU 
Lab of Origin
Westerfield Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 3089006 - 3089027 (GRCz11) (1) Details
Nucleotide change
CCGGAGCGGACTTGGCGGCGTA/-
Variant Notes
In b700, a 22 bp deletion in the third exon results in a frame-shift that leads  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
22 bp deleted in Exon 3 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TCCAATATTTAAAATACAAATACAATCTCGAATTCTAAATGATGATTGATCCAAAGGGTATGGTGGGAAGCAGCTTATTTAATGTCAGGCTCGTGAGTGGTGGGTCCACCTTCTGCTTGAAGAGTGCTGAAAGGTCACAGCTGCTCTATTCTTCCGCAGAAGGTTTTCGGTGCAGAGATGTGCCCGGTGCCACCTCGGGATCTCGGCCTCGGAAATGGTCATGAGGGCCAGGGATTTGGTGTACCACTTGAACTGTTTCACCTGCACGACTTGCAACAAAATGCTGACGACTGGGGACCACTTCGGCATGAAAGACAGTCTGGTGTACTGCAGGCTACACTTTGAAACGCTCATCCAGGGAGACTTCCCCACGCATTTCAATCACACGGATGTAGCGCCTAATAAAGGACTGAGCAGCACGGGCCCTCTAGGACTGTCTTATTATAACGGCGTGAACACAGTGCAAAAGGGCCGGCCCCGAAAGAGGAAGAGCCCTGGGC
CCGGAGCGGACTTGGCGGCGTA/- TAATGCAGGTGAGACCATCGCTCATCTTTGTGTTTTTATTGTTGCTGCTGGTTAACTGTTCTAGTTTAAAGCTTTTGTAAATATTTTTATTATTGTTTTGCACGAGGTGTAAGTGGATTTCCTCTGTGAAAAATTGCAGAACTTTTTAAAACCGCGTAGTAGTGTACGCCTTAGGGTTTACAAAAGTTTTTGGGCGTCACTTTATAAAAACCTCAATAAAATCGCGTGACGAATTTATAAAAGCAAGCTATAATGTTGAAGTTTGGTCAAAAATAATGTTAGTTATTGAACAATATTATTATTAGTTTTAAGGAATCATGGTATAATTAATTAATCGCAAATACACGTGCAAAACCTGTTTTTGGAAATACGAAAAAGGGAAAACAAATGTTTAAAAAGACGGGGAAAATAAAAAAAAAATTATCCAAACCTGACTAAAACTAACAATAGTTAACCTAATTTTAAAAATCTAGATAGAAATAATAAGCCTTAATACCTGC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
b700.pdf
Citations