Genomic Feature

b882

ID
ZDB-ALT-040519-2
Name
b882
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Westerfield Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 9: 28919096 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
The change predicts a transcript that retains intron 5 with a stop codon 84  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A in Donor Splice Site of Exon 5 (1)
Transcript Consequence
Intron Gain of Intron 5 (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
AAACACAATATTTCACAATTACTAACTACTTCAGACTTTTGAAAAGCAGTTTAATTCACTGTAATTACTGTTGCTTACCTTGTAGAGCATAGGAAGCCAACTCCACGGTTGTGTCGAATGGGCATTCTAGCCTAGAGTAAACAAAATCAAGTCTATTTAGACCAGAGGTATCCACACTCAGTCCAGGAGGGCAGTTGTCCTGCATAGTTTAGCTCCAATTTCCTTCAACACACCAGCCTTGAAGTTTCTAGTATACCCAGAATAAGCTTTATTAGCTGCTTCATTTGTGTTTAATTGGGGTTGGAACTAAAATATGCAGGACACTGGCCCTTCAGGACCAAGTTTGGGAACCACTGATTTTGACAATTTCTAAACGTATATCAGCTATCAAAAACCATAATAGTTTGAAAGGACATTTCATTTCTCAAATTTAAAATGGCAAAAGACAACAATGTCAATATTCTTTCCACACAATTTAACTCTAATCTTAAACTTCACTT
A/T CTTGCCACTGAGAATGTCCTGCTTTAACTGTAGAACAAAAAGGTATCTACAACAAATAATAAAGATAAAATGAGTGCAAAAATAATCAAGCGAATATTAGTTGTGTTTATGGCATAAACGGAGAATTAACCTTGTTAGCTCTTCATGCAAGTTGTTGGGCTCAGAGGAGTAGAATTTTACTCTCATATGGAGGCAATACGGTGGACCAACTGAAAGGCAGACAATACCAAATGAAATATTCAAAGCAAAACTGCTTACTAGAAGTGTGAGTTTGTACTGCACAAGTGTCAAGTTTGCTTTGGTATGTTTTAACACAGAACACTGCATAATAAAATAGGAATTTTAGACAGAATGCCATACAAGTGATGAGATACAGAGACTTTCCACTTCATGGTTTATTATTACCCGCCTTTCACAGACAGAGTTAAGCATTAACCATGTACTTATGAAAGTAGTCACAAAGACTAGTTAAAATGTTGCCCCGTTCTAAACCTTTGCTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations