Gene: mir7a-4
Accession: ZFINNUCL0000005679
Select Tool 
>lcl|ZFINNUCL0000005679|ZDB-GENE-141229-3 CuratedMicroRNAStemLoop mir7a-4 Gene 16  109 bp
GGGTGTAGTCCACTGCGGTGTGGAAGACTAGTGATTTTGT
TGTTTTTTTATGATGGAAGGAGACAACAAGTCATAGTCTG
CCTCACGGCTCTGAGATGAACGTCTTCAG
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.