ZFIN ID: ZDB-TSCRIPT-160112-819
Transcript Name: pdgfc-002
Previous Name: NTR95 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062829 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062829|OTTDARG00000043342| pdgfc|no_translation pdgfc-002 LG_none CR847496.7,CR456621.10,CT009687.10 Danio rerio protein_coding KNOWN, 983 bp
CGCCATCATCGTCCACTTACAGCGTGGTAGATGAGTAACT
TACATTACACAAATAAGAGTTACATTTTAAAGCGACGACC
AAATGAGAGAAGATAAATAGCATTACTTAACACTCAGGTT
ATCCCAGAAGACTTGGAACATTGTGTCAACAATACAGTTT
ATTTTCTTCGAGCTTTGAGGTTAAGTCGTGTAACTTCCTG
CAGACATTCTGCCTGAGACTCTATGAGCTGGAACGACAAG
ACGGTCTTGAAAGAGTGAGCGATATGCTTCATCCTTTCTC
TCATCCTTCATGTTGCCCACGTTGATGGCGGTCACCTGCC
ATTTCTTCTCTGCTGCTGTGTCCAGCACAACTTGGAGTGT
GCAGTGTAGCATTAAAGCCTTTCTCAGACTGCTGTGTGAC
AGCCGGATCAGAGCAGCACTCCTGAGATCCCTGCTGTGTC
AGGAGTGCACGAGTCTCAACACGAGAAGGTCCTCAGTGTC
ACTGGGGATGGAATTATTCAAAGTCCTAACTTTCCCAACA
AATATCCCCGAAATACTGTTATAGTGTGGCAACTGGTGGC
AGTCATGGAAAGTTCCAGGATCCAGCTGACCTTTGACCCA
CGCTTTGGCCTGGAGGACGCGGAGGAAGGCACTTGCAAGT
ATGATTATGTGGAGGTGGAGGAGCCTGTTGGAGGGATGGT
GTTAGGTCGTTGGTGTGGATCAGAGATGGTTCCGGGGCCC
CAGTTGTCCAAGGGGAACCAAATCCTGGTTCGCTTTGTCT
CTGACGAATACTTTCCCTCAGACCCAGGATTCAGCATCCG
CTATTCTTTGCTTCAACAGAGGCAGTCGGAGCCCGAGGCC
CCAGCGGTGATGCCTGTGTGGATGCAGCCTGTGGAGGATC
TGACTGAAGCCGTGTCCGCGTTCAACACCATGGAGGAGGT
GATGAAGTACCTGGAGCCCGAGCGCTGGCAGCTGGACATG
GATGACCTCTACAAACCCACCTG

pdgfc TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pdgfc-002 983
mRNA pdgfc-201 (1) 2294
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdgfc-002 Contained in:
OTHER pdgfc-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062829 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH538095 (1) 957bp
    GenBank:CV115320 (1) 729bp
    CITATIONS (2)