header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-8
Transcript Name: cacna1da-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062275 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062275|OTTDARG00000020450| cacna1da|OTTDARP00000048673 cacna1da-003 LG_none 4830 1 BX571969.5,FQ323136.2,CABZ01048890.1,CABZ01065553.1,CABZ01065554.1,CABZ01065555.1,BX248521.12 Danio rerio protein_coding KNOWN, 546 bp
CTCTCGCGCTCTCTCACGCGCAAAACAACGAATGAATACT
GATGAATCTGAATTCACCGTGTCAGATCGGACCCAAGCGT
TTTAATCGATGTCGGAGTTTTATCTCTGGATATAAGCCGA
ATCATCATCATCATCCTCAGCTGAAAGGAAAGACCTCATC
AAAGAGGCAAATTATGCCAGCAGTACCAGAGTCCCTGTCT
CTGGTGACGTGCCAGCCTGTTGGTGAGATCCTCCGCTCCA
GCGCCCACCCCTGTGCCCTCTCCCCTGGCAGGCCCATGCA
GGTGGACGCCCCGCTCAGGCCCACGCCCGCACCATGAGCG
CCAACGGCCCTGCTCCGCCTGCTGCGACTCCTGCCGCGCC
CCCAGCAGCTGCCGTGCCTGTACCTTCGGTGGTACCGGTC
GGATCGCTGGCCCAGAAGAAGCGGGCGCAGTATGCCAAGA
GCAAAAAACAGGGCAGTTCGGCCAATACGCGGCCACAGAG
AGCTCTCTTCTGCCTCAACCTCAACAACCCCATCCGCCGG
GCCTGTATCAGCCTTGTGGAATGGAA

cacna1da TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cacna1da-003 546
ncRNA cacna1da-004 (1) 840
mRNA cacna1da-202 (1) 5981
cacna1fb-207 (1) 6662
ottdart00000001787 (1) 2432
ottdart00000001972 (1) 4125
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cacna1da-003 Contained in:

OTHER cacna1da-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062275 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY528224 (1) 6514 bp
    GenBank:FP133312 (1) 688 bp
    GenBank:FP157176 (1) 483 bp
    CITATIONS (1)