Transcript

vars-201

ID
ZDB-TSCRIPT-160112-793
Name
vars-201
Previous Names
  • vars-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062750 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062750|OTTDARG00000043312| vars|OTTDARP00000049057 vars-001 LG_ CU929328.5 Danio rerio protein_coding KNOWN, 4150 bp
AATAAACTTTCCTACCTGCTTATTTCCAATGGTTTACATC
AGATGGTTTTGTTTATCAGGCACGTTCTTCTGTTATTGCG
TCAGACGAATGCGTTTTACGACAGTGTATGTTGTTTTACG
GCATTGCCGAAGTAAGCGTTGGATCGCCTGCATGCTGGAT
TTAGGCTGACGTTTCCGTACTGCTGCCTACAGATGGACAC
TCTCTACATCTCTTCCCACCCTGATGACTTCAGGAGTTTG
TTGCCCTTGATCGCTGCTGGATTCTGTCCGTCTCCTCCAC
GAATTCTCCACCAGGACCCTCCGGCAGAGTTGGCCAGATC
TCGGCCTGCGCTGGTTTTAGCAGGTGCGGGGGGCACTGTG
CTCAGCGGCACCAGTGCTGTGAGTTGGTATCTGGCAGCAA
CAGGCAAACGAGCCGGAAGTGATAAAAAGCAGGAGAGTCA
GGTGTGGCAGTGGCTGAGCTTTGCTGAGAATGAGCTGACG
CCGGTGGCCTGCGCTGTGGCCTTCCCTCTGCTTGGAATCA
TGGGAGTTGATAAGAAGCTTCAGCAGAGTTCCAGAGCGGA
GCTGCTGCGTGTTCTGAAAGCTCTGGATGGGACTCTTGCG
CTTCGGACATTCTTGGTGGGAGAGAGTGTTACTCTGGCTG
ATGCAGCTGTTGCGATGGCGGCTTTGCTGCCATTCAAATA
TGCACTGGAGCCTGCAGACAGGAAGTCGTTGGTGAATGTG
ACCAGGTGGTTTAATACCTGTGTGAATCAGCCACAGTTTC
TGAAGGTATTGGGTAAAATCTCACTATGTGAGAAAATGGT
GCCTGTGACCCCCAAACCCAACACTGCTTCCAATGTCACA
GTAACTGCTGCTGCTGCTGCTAAACCAGACAGCGGACCTG
CTAATGGTCCTCCTAAGACAGAAGCTCAACTGAAGAAAGA
GGCCAAGAAGCGAGAAAAGATGGAGAAGTTTCAACAGAAG
AAAGACATGGAGGAGAAGAAGAAAATGCAGCCTCAGACTG
AGAAAAAGGCCAAACCAGAGAAGAAGGAACTGGGTGTGAT
CACCTACAATGTCTCCACACCACCTGGAGAGAAAAAAGAT
GTCCTGAGTCCTCTGCCTGATTCATACAGTCCTCAGTATG
TGGAAGCGGCCTGGTACTCCTGGTGGGAGAAACAAGGATT
TTTCAAGCCTGAATATGGGAGGAAGAAACTGAGTGAGCCG
AATCCGCGTGGAGTGTTTATGATGTGTATCCCACCACCCA
ATGTGACTGGATCCCTTCACCTTGGTCATGCCTTGACCAA
TGCTATTCAGGACTGCTTGACGAGATGGCACAGGATGCGA
GGAGAGACAACGCTGTGGAATCCCGGCTGTGATCACGCTG
GCATCGCCACACAGGTGGTGGTGGAGAAGAAACTCATGAG
AGAGCGGAAGATGACCAGACACGACCTTGGGCGAGAGAAC
TTCATCAAGGAGGTCTGGAAGTGGAAGAACGAAAAGGGAG
ATCGCATCTATCACCAGCTGAAGAAGCTGGGCTCATCTCT
GGACTGGGACAGAGCTTGTTTTACCATGGATGATAAACTG
TCATTTGCGGTTCAGGAGGCGTTTATACGCATGCATGAGG
AGGGAGTGATCTACAGGAGCAAGAGACTCGTCAACTGGTC
CTGCACACTCAACTCTGCCATCTCTGACATTGAGGTCGAT
AAAAAGGAGCTGACGGGGCGAACTCTTCTTCCCGTGCCGG
GTTATAAAGACAAGGTCGTGTTTGGAGTGCTGGTGTCATT
TTCATACAAGATCGAAGGATCAGATGAGGAGGTGATAGTG
GCCACCACTCGTATTGAGACCATGCTTGGAGACACAGCAG
TGGCCGTTCACCCGGAAGACTCCAGATATAAGCATCTCAA
AGGGAAGATGGTCATTCACCCATTCTGTGACAGAAAGATG
CCCGTTGTGTTCGATGACTTTGTGGATATGAACTTTGGAA
CAGGTGCTGTGAAGATAACTCCTGCTCACGATCATAATGA
TTATGAGGTGGGAGAAAGACACAAGCTGCCCTTCATCAAC
ATCCTGGATGAAAACGGCCTCCTCATCAACGTTCCTCCTC
CATTCCTGGGGATGAAGCGCTTTGAGGCGAGAACAGCTGT
GCTTCAGGCTCTGAAAGACAGAGGCCAGTTTAAGGAGGTC
AAAGACAATCCCATGGTGGTGCCTGTCTGCAGCCGTTCTA
AAGACATCGTAGAGCCTCTGCTGAAGCCGCAGTGGTACGT
GGACTGCAGAGAGATGGGAAAACAGGCTGCAGACGTGGTC
CGAAATGGAGAGCTCAAGATCATCCCAGACCACCACCTCA
AAACCTGGTTCAACTGGATGGACAACATCAGGGACTGGTG
CATCTCCCGGCAGCTGTGGTGGGGTCACAGGATACCAGCG
TATTTTGTGACTGTGAACGACCCCGCGGTTAAACCAGGAG
AGGATGTGGATGGACATTATTGGGTGAGCGGGAGATCAGA
GCAAGAAGCCAGAGAAAAAGCTGCCAAACGCTTCAATGTC
ACTGCAGACAAAATCTCTCTGCGCCAGGATGAGGACGTGT
TGGACACATGGTTCTCCTCGGGGATCTTCCCCTTCTCCAT
CTTTGGCTGGCCCAATGAGTCTGAGGATCTGAGAGTCTTC
TACCCGGGCACACTGTTAGAGACGGGTCATGATATCTTGT
TCTTCTGGGTTGCTCGAATGGTCATGATGGGCCTCAAACT
CACTGGAAAACTACCTTTCAAAGAGGTGTACCTGCATGCA
GTGGTGCGAGATGCTCATGGCAGGAAAATGAGCAAGTCTC
TTGGTAACGTCATCGACCCTCTGGACGTCATCACCGGCAT
ATCACTGGAGGGTCTTTATGCTCAGCTTGCAGACAGTAAT
CTGGATCCTCTGGAGATTGAGAAAGCCAAACAGGGACAGA
AATCCGACTATCCCACTGGAATTCCAGAATGTGGGACTGA
TGCGCTTAGATTTGCTCTGTGTGCATACACCAGTCAAGGT
AGAGACATTAATCTGGATGTTAACAGGATTCTGGGATACA
GGCATTTCTGTAACAAGCTGTGGAACGCTGTGAAGTTCGC
CATGAGGACTCTGGGAGAGGGGTTTGTGCCTTGTGAGAAA
GCTCAGCTGTGTGGAAGTGAAAGTGTCTCTGATCGCTGGA
TTCTGTCTCGTCTGAGCGCAGCAGTAGCGTTGTGTGATGG
CGGATTTAAAGCCTACGACTTTCCCACAATCACCACTGCC
ATCTACAATTTCTGGCTGTATGAGCTCTGTGACGTCTATT
TGGAGTGTGTGAAGCCGGTGTTTAGCAGGACAGACTCTAA
GGGTCAGAAACAGGCTGACGTCTGCAGACAGACCCTCTAC
ACCTGTCTGGAGGTGGGACTGCGCCTCCTGTCCCCCATCA
TGCCTTTTGTTTCTGAAGAGCTCTTCCAGCGTTTGCCAAG
GAGAAGGCCTCGGGACAGCCCTCCCAGCATCTCTGTCACA
CCCTATCCTGACACTGCTGAGTTCTGCTGGCACAGTGAGG
ATGTGGACCGTCAGATGGAGTTTGTCATGTCTGTGGTCAG
AACCATTCGCTCACTCAGGGCTGATTACAACCTGACTAAG
ACTCGTGCTGACTGTTTCCTGCAGTGTATCGACTCCGAAA
CGGCCGCTCTGGTTCAGAAATACAGTCTTCAGATCCAGAC
CCTGTCTTACTCTCAGGCCGTTCACTCTGTGGTCGGAGAC
GCCGCTATCCCACAAGGCTGTGCGGTGGCCATCGCTTCAG
ATAAATGCACTGTCAACCTCATGCTGAAGGGTTTGATTGA
CTTGGGAAAGGAGGTCACGAAACTGACGGCCAAGAAAGGC
GAGCTGGAGAAACAGATGGAGAAGATGAAGGAAAAGATGA
CAAAGAACGACTACAAGGAGAAAGTTCCCGTGAAAGTGCA
GGAAGCTGATGCTGAGAAGCTGAGGCAGAGTGAAGCAGAG
CTGCAGAAGGTGAAGGAAGCCATAGAGAACTTCAGCAAGA
TGATGTAACATTTCACCCTCATGCTTTTTTTTTTGTATCG
TTTATGAATTTTTCCATTGAAATTCCTTTGTGTTCAATGT
CAGTCATGCCTAGTAAACAATAATGTGGGGAAGCTTGAAT
AAAAATTTATCTTAAATTAAATAGCTATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations