ZFIN ID: ZDB-TSCRIPT-160112-755
Transcript Name: si:dkey-280e21.3-202
Previous Name: si:dkey-280e21.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062634 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062634|OTTDARG00000043244| DKEY-280E21.3|OTTDARP00000048975 DKEY-280E21.3-001 LG_ BX511257.16 Danio rerio protein_coding KNOWN, 5934 bp
GAGAGATGGATACGACGCCGCTGTCTGCCGGCTGTGTGAG
TGAGATGGAGGCCGGTGGAGACGCTGAAGAGGGAGAGGCT
CGGGAGGGGAGCACGGAGTGCCAGAGACTCACTGCAGAGA
GAGATGAGGCTGAAAGGCAACTCAAGCACATTAAAAGAGT
TTCCCAAATGGTGATCGAAGAGGTGAACGTACTACAGACC
CAGCTTGAGATTGAGAAATCCTGCCGGGAAAATGCAGAGG
CTCTGGCTACGAAGCTGAACTGTGAGAACAGGAAGCTGAA
GTATTTGAGCCTGTCATCAAGGCCGTGTCTGGATGAGCTG
CTGCCTAGCATTTCTGACTGCATCTCGCTAGAAGAAGAGG
TTGAACAACAAGACCACAGCTCTGATTCATTTTCCCAATA
TAAGCAGCAGGTCAAAGATCTTCAAGAAACAGTGAGTTCT
TTGCTGGAGGAGAAGAAGCAGTTGGCTTGTCAGCTGCAAG
AACAGCAGAGACAAATAAAGGAGCTGACCGCACTTAGGGA
AAAGGAGCAGGCCGAGATGAAGGAGCTTTATAAAACCATT
GATCAGCAAAGCAAGACCATTAAGAGGTTCAACAGGGTAT
CTATGGTGGCCACGACTGAGTATGAAAACATGAAGGAGCA
GCTGGATTTGGAGCAGAGCCTCAGGCAGAAAGCAGAGACC
TATGCACATGAGATGATGGTAAAGCAAAAAGAAGCAAACA
GACAGAGCATGATCTTGCTCCAACAGGCAGATCCCAGCAT
TCAACTGCTCAAAGCTTTAGAAGATGTGGCCAATGTGACC
AAAACATTAGAGGAAGAGAGAATGCAGCACCAGGAGAAGG
TAAAGGCTCTAGAGACCGAACTGGAACAATGTGCTTTACG
TAAGCAGCTGGTTCAACTGCAGAGACAACTGGAAATATTA
GATGAAGAGAAGAAAGAGACAGAGGGACGACTACAAGAGG
AAGAAAAGAAAAACACTATTTTGGAAGAGAAAGTTAAAGA
TCTGCAGGAGGCAAGGACAAGCTCTGACTCAGCATCAGGT
CCCTCCCCCGGGACTGCTCCGCCCCCGGCCCCACCTCCCC
AACCTCCTCCACCTCCCCCACCCCCTCCTCCTCCACCTCC
CCCGCCTCCTCCATCCCGCTGCAACCCCCTCAGCTCTCTC
ATTGCGATTATGAGGAAGTCTTCCAAGGGAGGTAAAGGAA
CTCCAAAACTAGAGCAGGCCCCAGTAAATGAAGCTGTGGA
TGATGTCAAAGTGAAAGCTGTCAATGAAATGATGGAAAGA
ATTAAACATGGGGTTGTTCTCAGGCCTGTGAAGAGTCAGG
ACACTAAGCTGCCAAGCCCTGTGACAGCAGCCGCAGCTGC
AGCAGTGGAAGAGAAGCACCAGGAAAGTGCAATGGAGGAG
CTGAAAGGCATTCTGGAGACAGTGAAGAAGAGTCCTAGCC
GTGGCTTCCAGGAAGTAGCTCATGTTAAAAAGGACAGTGA
ACTGGAAGTAATTCTGAGGAGGAGACGCAAACAGGCCTGT
GATACTGGCGCAGAAGATAATGGGCAGCTGAGTAAAGTCT
CCTCCTCGAACAGTCTAAACGGCCGACACAGTTCTGACTC
TGGCAAAGACACAGAAGGACCAAGCAGCAGCTCTCTGTCT
GGCAGTGAACGAGGATCAAGAACTAGCTCAGACTCGGGTC
GAGAGCCAGCAGTGGTGCAACAGAGCTCAGATTCTGGCAT
GGAGTCCAAAGGAGCCGCTCAGACAGACAGTGACTGCAGA
TCCCTCACAGAGAAAGAGCCCATTGAGCCGATCACCAACG
GGTGCTGTTCGGGTGAAGGTCAAGATGGTGATCCTGAAAA
GTGGACGGGGCCTAATGGGATTGGCCATTCAGTTGCACAC
GGAGACCTGCAAACCACCATCAGCTCGTCTGCACAAAGCC
CCAATGCAGCAAACAGTAGCACAGACGCCGAGTGTTAACG
GCAAGTGGCGCTGCAAGGACAGCTGCATTATTTGCACAAA
ACCATGCTTTCTACATTTGTTCATTTCAAATTTAAAACCA
ACTTCTCATATTGTAAATGAATATAGAAAGATCATTTCAT
CATTTGCAGCTTGATCACAGTTGAAAAGAAAAAAACATCT
TACCAGGCAACACATTTTTCCTTTCACTGTACAATACTGT
ATCTGCCTTTAACCAATAAACACAGGTTGTTTAGATGTTA
GGGACATCTGTCATACACTTCAGAATAATCCAGCACAATA
GTTGCTATTAGATTCATCGTTGTATTTTCAAAAGAATGCA
AACAAAGACATTTTAAATATTATAGATTATTTCTGTGCCA
CTAGCAACAGCGTTTACTCTGAACAATATTGGTAGAAAAC
AATCCATTTACTGCAAAAAATGCTTTACTTAGATTTTTCA
TCTTGCTTCTAGTCCAAATATCTAAAAAAAAAAATAATTA
TTAGGCATTTTCTAGACAAGCAAAAAATATTGTTTTGCTT
TAAGAAATAATATGCCAACATTAGGTGAGTTTTTCCTTAA
AAGAAGCTTAACAATCTTCCAATGGGATAAGGAAAATAAT
CAAGTTTTTTGCTTTTTTCAGTTTATTCATGATAATTAGC
ATTATTAGAATATTATTAGTAATATATGCATCACCTTATG
GGGCAATGGGAAGTATATTTGGATTTAACTCAGTTTTTTG
AGAACACTTCGTTATTATTGTTTATTTATTCGTTTGCTGG
AAATAAGAACTGAGATTAGAAATACTTTGAAAACAAATCT
TTGCGCTTAACAAATGAAATTGAATATATAGGCTAATGGA
TGTCTTCTGTAGAGTGAGTTTCCACCATTTCTTTATCCAA
GAAAGTAAAGGAGTAAAGTAAAGAGTGAAAGTAAAGTAAA
GAGAAAGTAAAGAGGCCAAATGGAGGAGGTTCGTTCTTTA
TCTTCACATAGATGGTCTGTTTAATGGTTTTCTTGGGGTT
GAAACGTTCAGTTTTTTTACTTACATAGTCCGCCTTATAA
ATAGCAAATGCACCATGGCGTGATGCAACTGACTCTTAAA
GGGAATGGGAGATGAGACTCTGATTGGTTTAATGCACATT
ATGCTCAAAACGCACCCATAATTCATTAAGAGAATAAGCA
CAACTTTGTTAGACCATGTGTCGGGGCGCAAATCATATTT
TTCCATCCTTAAAATAGCAAAAGTGGATTTCAAACACTCT
TAATGCTTTTGCTGCATGCTCTTTAGACTTTGCACCTAGA
TCGTTAAAATAGAGCTCAACATGTTTTGCTTGTCTAGCGA
AAGCTTCTTGATTTAAAAATGTTTAGATATTTGGACTAGA
AACAAGACAACAAATCTAAGTATAAGAAAAGCATTCTTTG
CAGTAATAGCCTTCACATTATCTCTGTTCATTTGAAACAA
TGATATACACAATTTAAGATTTGAAAGATCTCATTTTGTT
TATGTTTTATGAAAAATTGCTCTCACATTGGCAATAACAA
CACTATTTTATTTACATAAAGATTCCGATTTGACCAATGG
CAGATGTTGCTGGTAGTACAGAATATACTTCACAGTCAAT
GCAAAGCAGCAAAACAATCCCTAATGAATCACTGCACTGC
ACATCATGGCACCTTTGCTGTTATAGAACAAAAAAAAAGT
GAGGACTAGACTATCCAAATTAATCAAGGGATGCAATTAT
AAGCCATGCAAGCGATTCTTACCTCACAGAGGAACTGTGG
TGGTCTGTTCTGTCTACCTCTCAAGACCCACTGACCTCTT
GGGGATCTGTAATCGTACATCCTAGACATTAGGAAAATGA
ATACCATCAAATCACGGAGGGCTACACACCGATGTCTTCC
ACTCGTTTTGCACTGCATGAATGCACTGTACGAAAGTTTG
GCTTTGGTTGACAGTTGCATCTTGATTTGATCTGCTCACT
AACTCTGAGCTGTTCCAATGCAATATCATCTGCGAATTGT
AATATCGTGCAGGATCAGGCTGCCTTTAATTACTGCAAAT
ATTTGCCTTGTGATTCTAAGTGGATCAAGTATGATGTGGT
TAATATATTTATGAGACAGTTGGGTTCTGGCCATTTCAGT
TGTCCAGTGCTTATTGCTCAGCTAAAAGGGAACATTCTCA
GAACGTTGGCTGATGTTGTGGATAGACAGATATAAACAAA
CATCTAGTAATGTTATTAGAATGTTAGTTAAAAGTTATTA
GTACTGCATCCGAAATCGCATACTGCTCGTTTAGGTACTG
TAATTAATATTCAGCGTACTTTATTATACACTGAATATTA
ACGTACTTTAAACATAATTTATTGTGACTGTTAGAAAAGT
ATGTTTTATATTGTATAAATATGAGAAGTTTGAATATAAT
TTAGATATACTACATCCTCCTTGTTGTTATTATAACCATC
TGCATCAGTTGCATTCATACATTTTCTTAGAATATTTATA
GAATTCAGATGTACTTGGCTCACTTAATGTTTTTTTTTTT
TTTTTTTTTTGCACACTAGACATTAGGAAAATATGCGATT
TCGGATGCACTCTAGGTCTTTATTATTGCTAGCACAAAAT
AAATGTTATTTGTACATCATTCATGGAAGGTTTTTAGTTG
GATGTTCATTCAACATTTTCCCAGAGTGTTTGCAAAATTA
CAAATAACAGATTGTTCCCTAAATGGTTTTTCTAACATTT
CTATAACAAAAAAACATGTTCAATTTGAAAAAATATGACA
TTTGGAACATTGTAGGTATGTTTTTAATGCACTTAGTATG
AACATTAAGTGAATTAATACCAAATGTACACTGAGTTGTT
TCAACCGAAACTTTGGTCAAACCTAGGCAAATCCAAAAAA
TTATTATTTATTATTTTTCTTTTCATTTTTATTATTATAC
CTTACACTTTTTTGGGTGGCAAGGTGGCTAAGTGTTTAGC
ATTGTCACCTCACAGCAAGAAGCTTGCTGGTTCGAGTCCC
GGGTGGACCACTGGGCGTTTCTGTGTGGAGTTTGCATGTT
CTTCCTGTGTTAGCGTGGGTTTCTTCCAGGTGCTCCGGTT
TCCCACACAGTCTAAAGACATGCTATAAGTCAATTGGATT
AACTAAATTGGCCATAGTGTGTGAATGTGAGAGTGTATGG
GTGTTTTCCAGTACTGTGTTGCAATTGGAAGGGTTTCTGT
AAAACATACAGTTGCCAATCAATTCCACTGTGGCAACCCC
TGATAAATAATGGACTAAGCCAAAGGAAAACAAATGAATG
AACGAATTAACTTACATTTTTAACCCCGTGATTGGACTTG
TCCATATTTTAGCCACAGTTTGCTTGAAACAACTCAGCAT
TTTATATATTTGCTACACTGAAGCGGATCAAGCAAACTAA
GAGAACCAAACTAAAAGTGCAAACACTCTCAGAAGTCAAG
TTTTTAGACCTTAATGGGAACATAAGCAAAACGTTCTTCA
AATATACTATTTATTAGCCGGGCGGTCTGACATCTTGCTA
TTGGACAACTGCAATAATATTTGACATGGCCCAATGTTGG
ATTGCAAATTCTGAATTATTTATGATTGCAATTTTGTATC
TAGTAGAGTCAGAAACGCTGAGTTGTTTTATTACATATTC
TTGTTTTCACACTGTCGTCACTAAAGATTCTTATAATTCA
CATTGACGTGATCTTTTTTATGTAGGAGACTGCTTTACAT
TGCTCCTTAATTTCCCACCACCTCTGGAATGTGTTTTGGC
CTTACTGTTTGCACCACTTCTTCCTTTTCAGCCTTATTGG
AGTGTTGGCTTGATTTTGTATAAGAACTTTGTGATTGAGG
CGATTGATCTGACTTGTGGTTTTGAAAATGAGTGTGTTTT
GAAGGTTAAACTGAGTGTACCTGTTTTTATTTGAATTGAC
TGAATTCTCCCTCTTCAATATACCTTTTAAACTGAATAAA
CTTATGACGAAATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-280e21.3-202 Contained in:
OTHER si:dkey-280e21.3-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062634 (1)
  • Ensembl_Trans:ENSDART00000173436 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC107510 (1) 984bp
    GenBank:CO923622 (1) 902bp
    CITATIONS (2)