ZFIN ID: ZDB-TSCRIPT-160112-704
Transcript Name: ankrd13c-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: artifact
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062475 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062475|OTTDARG00000043147| ankrd13c|no_translation ankrd13c-002 LG_none CU459093.10,FQ323135.7 Danio rerio protein_coding KNOWN, 1977 bp
TTACCGTTCGATGCGTCGCTCCGGTGCGTGTCTCATTCCC
GTCCGTCTCCGTTGAGTCACCGGACAGTGTTCATGTTGTG
CGGGCTGCCGTTCTCCGCCGCTCATCTGTGTAAATATGAC
GGGAGAGAAGATCCGCTCGGTGCGCAAAGAGCGCAAGTCG
GGTTTGGATCTACATGGTGAACGGGCTGGTTCTGGAGTCG
CGGAAGAGACGGGAACACCTGAGCGAGGAGGACATCCTGA
GGAACAAGGCCATCATGGAGAGCTTCAGCAAAGGAGGAAG
CCTCATCGAGCAGAACTTCGAGCCGATGAGGCGGCAGTCT
CTGACCCCTCCATCACCCAACACTATCTCCTGGGAGGAGT
ACATCACTGCTGAGACCGGGAAAGCTCCTCATCTGGGTCG
AGAGCTGGTGTGTAAAGAGAGCAAGAAGAACTTTAAAGCC
ACAGTAGCCATGAGCCAAGACTTCCCTCTGGGCATCGAGT
CGTTGTTGAATGTGCTGGAGGTCATCGCACCCTTCAAGCA
CTTTAATAAGCTCAGAGAATTCGTTCAGATGAAACTCCCG
CCTGGATTTCCTGTCAAACTGGACATCCCGGTTTTCCCCA
CCATCACTGCCACCGTGACCTTTCAGGAGTTCCGTTACGA
TGAATTCGACGAAAGCATTTTTACGATTCCCAGCGACTAC
AAAGAGGATCCCAGCCGCTTCCCAGACCTCTGAGCTGCTT
CACGTCCCACCTTACCCCGCTGTCCCGTCTCCATCTCGCC
TCCATCCCTCCGGTGACCAGCAGATGGAGCCCGGCGCGTT
TCACGTAGAAAATACTTGATGTAATATGGACATAAAGGGA
TTGCGTTGAAAACGGCGCGTAGGGAAGGGAAGGCCACTGC
TGTCCGAATATACGGGACTCTCCTGCACTACATGATCAAG
CTCTGTTCTGAGTTCTGCGCGAGAAATCTCCGATTGTGTG
TCGGAGCTCAGGACAGTGCGGTACGTTAGAAACACGGCGG
CTAGTCACTTCACGTCACCTGGCAGGAAAATATGGCATTA
TAAATTATTACATAAGCCGCGTTTTCATATATATCTTTGT
ACAACTGTTACAAACTTGTATACTTCACTTAAAAGCAAAG
TGTATATTTAGGAACGAAGCGGAAGGCGTCTGTATATGAT
TTGAAATCTGTCGCAGAATACTATGTAAATGTCATTTCTA
CGAGTTTCTTTGCGCAACTTGTAAATATATAACCTGCTCT
GGTTCCTGTTTTTGTTGCATTATGGGCTCACTTTCTCCTT
CACTGCATTTCCGGTGCTTTAGTTCACCTGCTTTACTTTT
CCTCACGTCCTAATAACTAGCTGACGATCTTACAGGGCCA
GATGTCGATGTAGCAGAACATGTTTTCGCCTGTAGATTTG
GTTTGGCTTTATGATAGATGGATGTAAATACATGCAAACT
GAAACATGTTTTCTCCAGTGTAGTATAATTGACATGTATA
ACTGACGAGTATGTTTATTGAGATATTAGTGTCAAATGTT
TCCGGAGACGTTGGGTAAAAGCCCTCAAGATACGGCGACG
GCTTATTTCATGAGTGTTTGATCTGTTTTTGCTGTGTGCC
GAGGGAAAAGGAGTTAGCGTCACGTTTGCACCAGCAATAT
CCCGTTGGAAAAGTACAGTTCCTCTTTTATGTCTCTTGTG
TTTTGGTTTTTCCTCTTCCGAATGGAAACGAGCTGCAACT
CTTCCATCACCCACTACTGGCTAGTGTGGAGAACTCCTGT
GTTTTGCTGTGTTTTTTATTTTATTTTTTATTATTATTGT
TTTTTGTTACCAGCTTCTTTTCCTGTGTTTGATGTTACTG
TTTTTAGCTTTATGACTTCAGTACCCTTCAGACTTTCTCC
CAGACGCATTGAACTCCCTGACGTACAGCGGGAACCTTGT
ATGAACCTGCTGCACTTTTACATGACAAATTGTAATTAAT
AAAATGTCCACGTATCA

ankrd13c TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ankrd13c-002 1977
mRNA ankrd13c-201 (1) 2855
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankrd13c-002 Contained in:
OTHER ankrd13c-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062475 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC161648 (1) 2037bp
    CITATIONS (1)