header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-521
Transcript Name: fgf13a-204
Previous Name: fgf13a-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062895 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062895|OTTDARG00000021166| fgf13a|OTTDARP00000049167 fgf13a-004 LG_none BX511059.10,CR847845.5,CR812761.4,BX004988.5 Danio rerio protein_coding KNOWN, 646 bp
GCATTAATGTAGGAGACAACGTGGAAGAGATAAGAGCTCT
TATCTCCTCACCTGGCACCTTTGTTTTGGATTTGCCAAGG
ATTTCCTAAAGCGGCAGTGGGCATACACGACTGAAGGATT
TCGGGTTTTAGTCTAATTCGGGATCTATACATCCAAACTG
GGATCTATGAGCGGAAAAGTGGCTAAGCCTAAAGAAGAAA
AGGATGCTTCAAAGGTCCAGGATGACGCTGCCCCAGGTAC
CCAGGAGTACATTATGTTGCGGCAGGACTCCATCCATTCT
GCGGATATAAGGGGTAAAGGCTCCCCTTTTCGTGCTAAGT
GTCACGAAATCTTCTGCTGCCCGCTGAAGCAAGTCGTCCT
CAAAGAGAACTCAGAGCCCGAAGAGCCCCAGCTGAAGGGG
ATCGTAACGAAGCTGTACAGTCGACAGGGCTTTCATTTGC
AGCTCCAAGCAGATGGAACCATCGACGGCACTAAAGAGGA
GGACAGTGGTTTTACCATGTTCAACCTCATACCAGTGGGC
TTGCGAGTGGTGGCCATCCAGGGAGTTCAGACCAAACTCT
ATCTGGCCATGAACAGCGAGGGCTACCTGTATACATCAGA
ACACTTCACACCAGAGTGCAAGTTTAAGGAGTCTGTATTT
GAGAAC

fgf13a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fgf13a-202 (1) 1130
fgf13a-203 (1) 2383
fgf13a-204 646
fgf13a-205 (1) 659
fgf13a-206 (1) 777
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fgf13a-204 Contained in:

OTHER fgf13a-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062895 (1)
  • Ensembl_Trans:ENSDART00000172873 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB944930 (1) 185bp
    CITATIONS (2)