header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-502
Transcript Name: pdgfc-201
Previous Name: pdgfc-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062828 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062828|OTTDARG00000043342| pdgfc|OTTDARP00000049116 pdgfc-001 LG_none CR847496.7,CR456621.10,CT009687.10 Danio rerio protein_coding KNOWN, 2294 bp
TAGTTTTCTCCAACTGTCCCTGTGTTTAGGCGAACAGGTG
TGCGCTCACTAACAACTATTAATGCTTAACTTTGCGCAGA
CGCGTCTCGGAAAACTTTAGAAGTTTTCGCTGCAGAAACT
CTGGCTGATCAGGATTATGTGGACTTTACTTTACGCGTGC
CCCTTACAGATGTGTCCAAAGTTGGATACGCGTCTCACGA
ACAATATTTCTGCATGGTGATTGAAACAACGCATACTAAG
TGCACCGACAGCCACCATTTATCCAAATGATTCCGTTGCT
TCTGTTGATTGTTATATCGTCTCTTCATCAACATGAGTCG
GTGGCGGAATCGAGTCACATCAGTAAGATTCACCACGCCA
GCACGAAAGAACAGAACGGAGTGCACGAGTCTCAACACGA
GAAGGTCCTCAGTGTCACTGGGGATGGAATTATTCAAAGT
CCTAACTTTCCCAACAAATATCCCCGAAATACTGTTATAG
TGTGGCAACTGGTGGCAGTCATGGAAAGTTCCAGGATCCA
GCTGACCTTTGACCCACGCTTTGGCCTGGAGGACGCGGAG
GAAGGCACTTGCAAGTATGATTATGTGGAGGTGGAGGAGC
CTGTTGGAGGGATGGTGTTAGGTCGTTGGTGTGGATCAGA
GATGGTTCCGGGGCCCCAGTTGTCCAAGGGGAACCAAATC
CTGGTTCGCTTTGTCTCTGACGAATACTTTCCCTCAGACC
CAGGATTCAGCATCCGCTATTCTTTGCTTCAACAGAGGCA
GTCGGAGCCCGAGGCCCCAGCGGTGATGCCTGTGTGGATG
CAGCCTGTGGAGGATCTGACTGAAGCCGTGTCCGCGTTCA
ACACCATGGAGGAGGTGATGAAGTACCTGGAGCCCGAGCG
CTGGCAGCTGGACATGGATGACCTCTACAAACCCACCTGG
CAGGTGCTGGGCAAATCCTTCTTCCACCAGAAGAAATCCA
GAGGAGCGGTGGATCTGAATCTGCTTCGTGAGGACGTGCG
GCTCTATAGTTGCACTCCTCGTAATTTCTCAGTGTCTTTG
CGCGAGGAGCTGAAAAGGACAGATGCTATCTTCTGGCCCA
GCTGCCTGCTGGTGAAGCGCTGTGGTGGAAACTGCGCCTG
CTGTTCTTACAACTGCTACGACTGCCAGTGCTCACCCACC
AAAGTGGCCAAAAAATATCACGAGGTTCTGATGCTGAAGC
ACAGGACAGGGGGTCGGGGACTGCAGAAAACCCTAGCAGA
CGTCCCTCTGGAGCACCATGAGGAGTGTAACTGTGTGTGT
AAAAATGACTCTGACTAAATCAGTCCCAGAGAGAAGACGC
ACACCGGCCCCCCGCAGACTCACCCAGGGAAATACCCCTG
CTTTGTGCATAAATGAGCGAAAGATGCTGCAAACTAATGA
AACCCAGCACTGGATGCCTTCTTTTTTTCATCTTGACTCA
TCTAAGCCTGCGGTTCCATTCCTTTTGGCCTCGCAAATCC
ATAAAGGATTGACCCATAAAGAAGTTTCCATTGGCCTTAT
GATAGCATGGAATATTTGGAGGGAAATTGGACACGCTCTT
GCATTCTCTGTGTGTGTGGAGGTTTGTGAACAATGTGTAC
ATTTGTGGGTCTTTTTTCAGTTCACGTATATAGAGCAGAT
CAGGAAATGAGGTATTCCAGGATAACTTGAGGTTGCTTTT
ACTTGGGGAACAAGTGTATTTGGCGTGTTTTTTTAATTAT
TATTTTTTTTACAACTTAATATATTAAAGGACCTTGACTA
TGTTTCTGCTTTCAGCAATAAGTTTTGAGGTGGTGTGGAC
AATATCCTCAACGTCCCAAAGAAACAAATAACACTGTGTT
ATAAACCAGCACTCCGTCACCTACTCATCATGAAACTGAA
ATGATTAATAGCTCATAAAGACTATCCCAAGAGCGATGAA
CATCATGCCTGCATCTTTTGCTCATTCACTTTGAACTATG
AGAACACTAAAGCGAATCTTTGTGTAAATACATTTAATAT
TGTGATCTGTTGACTTATCCTATATGTCGTTACAGTTTCT
GGTACTAAAAGTTTGGGGTATATAAGAATCACTTTTCCCT
TTTTTTCATAATCGCTAGTATTTTCAGTATTAGTCACTCT
TTTTGTAGAGACATTTATACATTTCTTGTGTTTTTATTTG
CGTGTTGAGATCGTCATTCTGACTGGAGACACAAAATATT
CTGTTAGATGTTCATGTAAATAGACTTTTTAGAAGTTAAA
GGGACATTGGAACAGCCAGTACCTTATTCATCTACCATTA
AACAGTTAACTAAA

pdgfc TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pdgfc-002 (1) 983
mRNA pdgfc-201 2294
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdgfc-201 Contained in:

OTHER pdgfc-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062828 (1)
  • Ensembl_Trans:ENSDART00000074710 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN899930 (1) 621 bp
    GenBank:CR929300 (1) 539 bp
    GenBank:BM025818 (1) 379 bp
    GenBank:CB363955 (1) 223 bp
    CITATIONS (2)