ZFIN ID: ZDB-TSCRIPT-160112-186
Transcript Name: gria2b-206
Previous Name: gria2b-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062833 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062833|OTTDARG00000021247| gria2b|OTTDARP00000049118 gria2b-005 LG_none CR456621.10,CT009687.10 Danio rerio protein_coding KNOWN, 446 bp
CGATAAAGGTGAATGTGGAGCCAAGGACTCTGGAAGTAAG
GAGAAGACCAGCGCGCTCAGCCTGAGCAATGTGGCTGGCG
TCTTCTACATCCTTGTGGGCGGCCTGGGCTTGGCCATGCT
GGTGGCCCTGGTCGAGTTCTGTTACAAGTCCCGAGCCGAG
GCCAAGCGCATGAAGGTGACCTTTTCGGATGCTATGAGGA
GCAAAGCGAGACTGTCTGTTACTGGGAGTACTGGCGAGAA
CGGACGTGTGATGAGTCCTGAATTCCCCAAAGCCGTACAT
GCAGTGCCCTTTGTTAGACCTGGTGTGGGAATGAACGTCA
GTCTGACTGATCTCTCCTGATGGATAAGAACCTGCCGAGT
GCCTTACACAATGGTTTTCAATAGAGCGCGTTCTATTCTC
TTTCCTGTCGCTCTCTCCCTTATCATCACTCGTCTGAATG
GAGGAT

gria2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gria2b-003 (1) 671
gria2b-004 (1) 535
mRNA gria2b-201 (1) 4505
gria2b-202 (1) 3011
gria2b-205 (1) 2724
gria2b-206 446
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gria2b-206 Contained in:
OTHER gria2b-206 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062833 (1)
  • Ensembl_Trans:ENSDART00000173093 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM035121 (1) 446bp
    CITATIONS (2)