ZFIN ID: ZDB-TSCRIPT-160112-121
Transcript Name: cplx2-201
Previous Name: cplx2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062635 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062635|OTTDARG00000043245| cplx2|OTTDARP00000048976 cplx2-001 LG_ BX511257.16 Danio rerio protein_coding KNOWN, 5772 bp
CAGCCTGGACCACAGAACCGCCACCTTGCTCTCTCGCATC
GCAGAGGTGTGAATGATTGTTTAGGACTCAACACTGTGGT
GGAGCGGTACATTCAGGATCACGGCTGGACTAAATGCAAC
ATTCTCTATAGCTATAAGAGGAGCAGATATCTGAGTGCAT
CATGGATTTTGTGATGAAGCAAGCGCTGGGCGGGGCCACC
AAAGACATGGGAAAGATGTTGGGTGGAGAGGAGGAGAAGG
ACCCTGATGCCCAGAAGAAGGAGGAGGAGAGACAGGAGGC
TCTGAGACAACAAGAGGAAGAGCGCAAGGCCAAACATGCC
CGAATGGAGGCAGAGAGGGAAAAGGTCAGACAAACAATTC
GAGATAAGTATGGGCTAAAGAAGAAAGAAGAGAAGGAAGC
AGAGGAGAAAGCGGCTATGGAGCAAGCATGTGAAGGCTCC
TTGACTCGCCCCAAAAAGGCAATCCCTGCAGGATGCGGAG
CAGACGATGAGGAGGACGAGGAGAGCATTTTGGACACCGT
TCTCAAATTCCTTCCCGGACCTCTGCAGGACATGTTCAAG
AAGTAACAGCACAAAGCTGTTTCTGAACACAGATGAGTGA
GGGGAGATTTTGGCCAAACAGGTGAAAGGCTTTTCACTGC
CTTGACGGAATTATATTCGCTCCTTTCTACAGAAAGAAAC
ACAAATCACAAAACGACAACATTTGGTCTTTTCACTGCCA
TTCAGGTTCAAATTGTTTACACTTTCTCTAGTGCTCTCGG
TTTGTTTACTAATCATCAGGGTCGCTAATACTTTAAAAGT
TAATCTGCCTTAGGTAATGAACATCGACCCCAAAATAACA
GCACATTCCAGGATGATGATACAGAGCTCATCAAACGTGA
TGGATTTATTTATTTATTTCAGAGCATTCACAAACAGTAT
CTTGATACAATCGTTTGCAGAAAAATACTGTCGATGAAGT
GCAGAGATTATGTGAATGGGGTCAAAATCTCACTACCATA
TTTTCCTGGAATTTAAAAGTCAGTTATAAAGCAAGTAACC
AGAGCATGCACAAGTCATGCAGATATTTAGATTTGCGCTG
GATGAAAGAGACACATCAATATTTGTACAGCACAATTCCT
ATATGCCGCTAGTTTCTGTTTCAATTTAAATACATTTGCT
TAGGCTTGATGTTTCTATTAAATGTTGATTAAAGTGAACG
GCTCTATATATATATTTTTTTTTTGTTGTTTTATAGGCTG
CTTATATTTTTTGTTTCATCTTCTCTTCTGAATACTGGTA
AATTTAAAGCATTTGTTGTGCAATTAACCGAAATATACAT
ACACTTCTTATTTTATTTAGTGCTAACAGTAGCCTATTTT
ATATTATTTCAGGATTAAATTATAAGATACAACTTATACA
CCAAGAGCACTTTTTACAGAAATGCAATTATGACCCCTGA
CTTAATTTCCGGAAAATATGGTATCTAATGAATAACATTT
GCCATCAGGGAGCTTGTTGATATGTTGCCATTTGTAAAAA
TGGTAAACATTGTTATACTGTCTTAGAGTACATTATACAA
CAACAATATGCTAAAAATGGAAGCGTTTCTCCCTTGCATT
TATGAAAAGTTTCACTGTTATATGCTATCAAAACAATACC
CATCCACATAGATCCACAAAAACGACTGAAAACTACTGTA
ATATGCATGCCAGACAAGAAGAATACTATGTGTTTGAGCT
ATATGGTCCTGTAACATTGTTGTTTTGGTAGTCAAGTACT
CGTGCATGACTATAAATGAACCATAATACATGTGCATGAT
GTCACTATATTGCACAGAATCTATGATTTGCACACTGAAA
ACAATGTTATTCTTATCAAACTTTGTTAAAACTTTATGGT
ACCCGAAAGTTTTCTGTTTTTAGTGTAAAATTATAAAAAA
AAGTTTTGTTTAAAATTGTAAAATATCCTTTGGGAGAAAT
TTTGAAACATGAACATATATTCTGTATTCTTTCTGCATAT
GTACACATGCATATAGTGTTTGTTTGCAACATGACATTGC
CACCTACAGGCCTGGCATGCATAATACAGTGTTTTCAGTT
GCTTCCGTGGATCCGTGCGAATGGGGATTGTTTTGTCAGT
ATAACATTTTTTTCAGAAATGCAAAAAAGAACGTGTTCAG
TAGATTGTTGTCATGTAGAAGTACCCCTAGTTGTGCCACG
TTAGACCACCTGAGTGCTCAAATGGTTTTGCAGCCTGGCA
GTTCTCAGTTTTGTATTATTATTTATTTATTTCAATTTTT
CTTGAGGTGTGAAATAGAACTTGATTTGACCACAAGTAAT
ATTTACATTAGCCTTGCCAGCAAAAGATCAGGAAAACTGG
ACCAAATTATCCTTACAACGAACAACCATTCAGGACTAAT
CACAATCTGTCAAGCACACAGCAGATGAACCTTTAGACAT
TTACTATATATTCAGTCACGGTTTCACAGCACATTCATCA
CTGCCAAAACAAAACAAGCAGATGATTTGATACAAGACCA
TTCACATGACAATCAGAAATGAACTGATCTCATCCAGAAA
AAAAAGTTATTCATACATACTTCTATTAAAAGCAAAGCAT
TGTTCACTAAATACTGTATATGATGTCCCACAACACAAGA
TTATCTCCCAAGCTCATGCCTCAGGTGCTGTTTACGCTAA
TGCTTTTTCACTTTAAAACAGATAAGTTATGTTACGGTCA
TGGCAGACATTCACACAACTTTCCACTAAAAAGAAGTGTT
TTGCAAACTATTGACCTTGACACTGGAATATTTTTTGGCC
TGAGACTTCCGGTCTCGTTCACTTCCATTGATTTTTAGAC
AATAAAAATGACTCGTTTTGCTGCTTGATGTTGCAAACTG
CTTTTGTCTTATTACATTATTCCACTTTTTATGTACAGTC
ATGAACACACTTGTTTGTAGAGCAAGTAGTTTGACCGTTT
TCTGCCATCATTTCTCCCATAGACAAATCGGATTTGGAAG
TTCTAAAATAATCGTAAAACCAAAACTCTTTCGAATTGAA
GAAAGTCAATAAAGGCTTAGTTTTAGCTTGGTAAATGCTG
GTGTTCCGCTTCAGAATAGACTCACAAAAACATTCAAGAT
TTCAACTTTCAAGATGTCCTCGCTACTGTCTGTAGTACGA
TGATGAACTGGTTCAGGTAAAATACATAAAGGACATTGTA
ACACCCACTATGGTAATGCCCATGTTACTGCTATGGCTGA
GTTTAAGGTTGGGGTTGGTGTAGCTGTTAATAACTGTGAG
GATTGGGGTAGACATAGACATTTATAACACACAATGTAAT
GGGTAATTTAATAATTAACAGAAATAATTTTCATGTGTAG
CTACAACAACTTGTGCATGCACATGCTCTACATATAGAAC
CTGATCCAGTATGTCACTGTGCTACAGGCTGCAGTGAGGA
CACACTCCAAACTTTTGATAATGGAAGTGCGACTATACTC
ACTGGCTCATACTCAATTTACTACTCTGTAGTTGGAAAAA
CATGTTATATACAGTGAATGTGAATATGAATGTGAGCAGT
ATGAACAGAACTCGGACATAGTGTACTACACCCGCCATTT
TGTCTTGATCACGTGACCTATCCATGTCAGTTGCGTTCTT
TCACTCCCATTTATGAATTCTCTTGTGGTACATCATGGGA
TATCATGAGATGCACACTTCAGAATCTCGCCGGAAAAATT
AGGTCATTCGAGTACTCGAATACTGTTCTACTAATTTTGA
CATACTACTCAGCTCGCATAGTGTTTTGAGCATAATATCC
GCTTCTGAAGTGTGACGTCATGCGATGCGGCTTCTGGGTC
TAAGAACTATATGAAACTGCAAGGGGAGACTCAACAAATG
TTAATAATAAACATTTACAAAGCGGGGTAATACTTTCGAA
AATCATGAGCACAATGTATATACCCATGCTTAATATCAGA
TAGCCAGAAAGTGATAATTTTTTTGTATAAATTGTTACAA
TTTTGGTATTTGTGATGCAGCAAGTCTAGAGACATTCATT
TTAATGTGTGATATAACTAAAAATAGGTCATAAATGAATA
TTTTCTCAATTCAAATGAGTAGCGGCTTGGACCCGGAAAC
AGTATTCTATACGTCACTGATACACCATGACTTAATGCGA
TTTTGGATGCAGCCACTTACTTACTGGTCTTTTGGACTAC
TGTGTTTTGTTTCTTGATTCATTAACCCTCTCATGCAACA
ATTAGGCAACCGATAAAGTATGGATGTCGGCAAAATATGT
GAAAGCACAATGAGCGTGAATAGTCATGTATCATGCGTTT
AAGTCAATATTGTGTAAATTTTTTCTGAAACGCATTAAAA
ACAAGCAGAATTTTAATTTTTTTAATTAAAAATGCATTGT
TTAAACAGCAGCTGATATTAAAAGTTATTTTTACAGGTGG
GGTTTGGGAGGATTTTCATGCTAGTTTGTAAAAATAATAA
TTAATACAAATGAGATTATACAAATTAGCTTTTATTCAAA
ATCTAAAATAGTTGTTTTCCAAGAGATCAGTTTACGTGGT
CTTTTAGCATGTCTTTACATTAAAAAAAACTGCCTGTGTG
TAAGATACTGAATTCAGTATTACTTCCCAAAAAAGAAGGC
AATGCTTTCGATGATGATAACTAATTATACAAATAACAAA
TGAATACTAGAATACATGAGCTTCAATCACTGCTATAGAA
AAAAAGACCAAAGAGAGAATGAGCTGCAATCCTCCACACT
ACTACAGACATGATGATGAAATTGTGAGAAACTATTAATA
TTCCTACTACATCTGATCAACAAAAGTCCTTCCCGCTGTG
AAATTTCTGCCCAAAATATTAATCGTGCTGCTGGCAAAAT
CTGATGTTGAGTTGACTTAAGGCTTTTTTATTATTATTAT
TTACATTTTTAAGGTCTTACAGTACGTTTTTGAGCATTGA
GTAAACACTGCCATTTGATAAACATGTCAGAAACATATAT
TTGGGAGGGAGGGGTTCAATGTTTACATATGTTTATGAGT
AGATGAAGAGGCAAACTCATTTTTGTAAAGTATTGCATGA
TTGGGGAAATATGAAACCTGTAGATAAGCTTTCATTTTGT
TGATTACACAAAGTTAGCAGTTGTATGTTTGACAAAAAAA
GTGTCCCTTTTTAAACTGTTAGCAATTGATATAACTACAG
GAATGTATATGTACCCGTTATAGGCTGGTTGTTCTGTGAT
CACAGCAAGATTGTAAACTTTGTTTCAAAAATAAAAATCT
TAGTAAGAGCAGAATGACATACTTTAGATTAGCACATGCT
ACTCTTTTCATTTTAGCTGTACAAAAGTACACCTTTTTTA
TTATCCGATTACGAATTTAAAATGGACTTTTTCATTTTTG
TAGTGCTGAAAGGTTTTTTCCACTAGTCAAAGCCATATTG
TTAGACTGCAATAATTAATGAAAAAATACTCATCTTGTAG
TCATGCATCTGTTTCTGTAAAACAAAACAAAAACAAAAAA
AACTGTTGATATCTATTGAACTCTTCATGTCTGAAAGTGT
ATATGACATTTCCTGTAGAGAGAGAGAGAGTCTTTAAAAA
GAAGCTACTGTATGTTCTCTATGTATTTATGTGCGTCTGT
ATTTGTTTGTGCTGTAAAATGTTCTTTCATGTTGTATCTA
TCTGTTCATGTCTTGGTCTAAAGCAAACTGCATCGGGTCC
TAATGTTTATGTATGCATGCAGATGATTTTTGCATTAAAT
ACCAAATCGTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cplx2-201 Contained in:
OTHER cplx2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062635 (1)
  • Ensembl_Trans:ENSDART00000163669 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK025547 (1) 1108bp
    GenBank:CA472078 (1) 904bp
    GenBank:CO925542 (1) 616bp
    GenBank:AI722907 (1) 526bp
    GenBank:AL919623 (1) 514bp
    GenBank:EH480735 (1) 387bp
    CITATIONS (2)