Transcript

scarna1-001

ID
ZDB-TSCRIPT-150915-1
Name
scarna1-001
Previous Names
None
Transcript Type
snoRNA
Annotation Status
published
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Sequence
ZFINNUCL0000006141 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000006141|ZDB-TSCRIPT-150915-1 publishedRNA scarna1-001 snoRNA published 167 bp
ATGCACCAGATACTGACCTGTCTGCCAGCAGCTCAGTTTT
TTTCACACTGATGCCTGCATGACTGTGGCTGTCAGGTCCA
AACCGGTGCAACAAAAAACACAAGACCCTGAGATTTAAGC
CCTGAGAAAGAGGAACTCCTCAGGTGTTATAACTCAAGGG
CACATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations