ZFIN ID: ZDB-TSCRIPT-141209-81
Transcript Name: ottdart00000022285
Previous Name: hspa9b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022285 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022285|OTTDARG00000018384|ZDB-GENE-030828-12 hspa9|OTTDARP00000018681 hspa9b-001 LG_ BX000526.8 Danio rerio protein_coding KNOWN, 3287 bp
ATCGCACTGGTTCTACAGGAGCAGGGTTTGATCCATTACC
GAACATTTATTTGACTTTCGTCTGACGAAAAAACCTAACC
AAAGACTTTTTATCAACGTTCACTTAACAAATAAATAAGT
CAAATATGTTGTCTGTGTCGAGAACGGCAAGGTTAGTGAG
AAATGTGTCGTGCTCTCAGAAAACCTCCAGCGGTGTGTCA
GATCTCATCAAAAAGGCTTGTCTAAATGGATGGACACAGA
AAACTCTCCAGACTGCAGCCAGACGTCATTATGCGTCAGA
GGCTATCAGAGGAGCTGTCATTGGCATCGACTTGGGAACC
ACAAACTCCTGCGTGGCTGTGATGGATGGAAAAAATGCAA
AGGTTCTGGAAAATGCAGAGGGTGCAAGGACAACCCCATC
AGTGGTGGCTTTTACATCTGATGGAGAGCGGCTTGTAGGA
ATGCCAGCCAAACGTCAAGCTGTTACCAACCCCAACAATA
CTCTTTATGCTACAAAACGACTGATTGGACGGCGTTTTGA
CGACGCTGAAGTTCAAAAAGATTTAAAGAATGTGCCATAC
AAGATAGTCCGTGCCTCTAATGGTGATGCCTGGCTAGAAG
TCCACGGCAAAATGTACTCACCCAGTCAGGCTGGAGCATT
TATACTCATTAAGATGAAGGAAACTGCTGAAAGCTACTTG
GGCCAGTCAGTGAAGAATGCAGTTGTTACAGTACCAGCTT
ACTTCAATGACTCCCAGAGACAGGCAACTAAGGATGCTGG
ACAGATTGCAGGTTTAAATGTGCTCCGTGTCATTAATGAG
CCAACTGCTGCTGCTTTAGCCTATGGACTGGATAAGACTC
AAGACAAAATAATTGCTGTTTATGATCTTGGTGGTGGAAC
CTTTGACATCTCTGTTTTGGAGATCCAGAAGGGTGTTTTT
GAGGTGAAATCTACCAATGGAGACACCTTCTTGGGAGGAG
AAGATTTCGATCAGCACCTTCTCAGGCACATAGTCAAAGA
GTTCAAGAAAGAGTCTGGTGTGGATTTGATGAAAGACAAC
ATGGCACTGCAGAGGGTGAGAGAGGCAGCAGAGAAGGCAA
AGTGTGAACTGTCTTCCTCTTTGCAGACTGACATCAACCT
GCCATACCTGACAATGGATGCTTCAGGTCCTAAACACTTG
AACATGAAGCTCACACGGTCTCAGTTTGAAGGTATAGTGG
CAGATCTCATCCGCAGGACAGTCGCACCCTGTCAGAAGGC
TATGCAAGATGCTGAAGTCTCCAAAAGTGACATTGGCGAG
GTTTTACTAGTTGGCGGAATGACCCGAATGCCGAAGGTCC
AGCAGACAGTTCAGGATCTGTTTGGCCGTGCTCCCAGTAA
GTCTGTTAACCCAGATGAAGCTGTGGCCATTGGGGCAGCC
ATCCAGGGTGGAGTTCTTGCAGGGGATGTGACGGATGTGC
TCTTGTTGGATGTTACCCCACTGTCTCTTGGCATTGAGAC
TCTTGGAGGAGTCTTTACCAAACTCATCAACAGAAACACA
ACCATTCCTACCAAAAAAAGCCAGGTGTTCTCTACTGCGG
CTGATGGACAGACTCAAGTGGAGATTAAGGTTTGTCAAGG
AGAGCGAGAGATGGCTACAGACAACAAGGTTCTGGGACAG
TTCACTCTGGTTGGAATCCCTCCTGCTCCTCGTGGAGTTC
CACAGATTGAAGTTACCTTTGATATAGATGCTAATGGGAT
AGTACATGTCTCCGCTAAAGACAAGGGCACTGGCCGAGAG
CAACAAATTGTCATCCAGTCATCTGGTGGCTTAAGCAAAG
ATGACATTGAAAACATGGTCAAGAATGCTGAGAAGTATGC
GGAGGAGGACAGGAGAAGGAAGGACCGTGTTGAAGCAGTC
AACATGGCAGAGGGTATCGTTCATGACACCGAGTCAAAGA
TGGAGGAGTTTAAGGATCAGCTGCCAGCTGACGAGTGTAA
CAAATTGAAGGAGGAGATCAGTAAAGTACGAGAGCTTCTC
TCGCGAAAGGATACCGAGACAGGAGAGAACATAAAACAGG
CAGCCACAAGCCTGCAGCAAGCCTCACTCAAACTGTTTGA
GATGGCATATAAGAAGATGGCATCTGAAAGGGAAGGCAGC
AGTGGCTCAAGTTCATCAGGAGAAGCAGGAGAGAAGAAGG
AGGGTCAACAGTAAAGGCGGTGACCGTTGAGATTGTTTGT
GGAACTGAATGGCTTGGGAGCGTGAATTTGTTTTCCTGAG
CAGCGTATGCAGAATATTCTCAAACATACTGTGTTTTTGG
CAGTAATTTCTACAAAACTAAATTGTCGTTTTTCCTCATT
TACCTCCCTTACATTGTTTTACATTCATTTGTGTCTGCTG
TAAATCTGTATCAGTCTTGGAAAATAAATGTGCAGCATGT
TCGATTTGCCACCGTGGCTTCAAAAATCAGTGCAATACAT
GTTAGCTTGACAAAATACATGCTCTCACCGCAGGCATAAT
CCTATTGCCATTTAGAGATGCATTCCAGCCATTTGGCCTC
AGTGTTGTATGGAGTCCTGTTTTTGAGTTAATTATTTTTA
TTATTACTGAAAATGTGTGTGTTTTGACCTGATGGGGTGG
AATGCATGTCTGAATGGCTTTAGGGTGTATTTACAGTTAG
TTTATACTGAATACTTTAATACTTAAGTGTGGCTTAACTG
TTTCAAGAAAACAAAGTTTTATTATAATCACTAGAGTATC
TGTTCTATCAATTCTCCTTGAAAATGCATCGATTTCAAGC
TTGTGCCAGTCAGTTTGAGGTTGGGTATGAAACTATGAAT
AAACCTAGGTAGCGTGGAATTGATAGTCAAATTGTCAGTT
TGTTCATACAGATGCTAGTGCACATAAAGTACATTAGTAC
GTGTATGTTAGCTTGACATGTATAAACCTGTATCTCCAGA
CTAGATGATATTTAAAATGGATGCTCAAGCAAACAGGTTT
AATTTCATTTTAATCTATGTATTGCTGTTAATGACAATAG
TGATTTATTACAAGTCAGGCTGTCTTGAGTGAAGGATCAA
CTACTTATTGTCATTTCCTTGCTGCAAAATATAACACAAT
CCCATCTTCTCTGTGCTTTTTCTATATGACTTTCTGGTTC
ATTTAAAGAAAAATAAAAACTAACCACGGTTGCTCTGTAC
AAAAGCTGTTGTCTGTTTAAAAGAATTGTAAAATGTTCAA
AATGGAATTGAATGAATAGATGAGCCTAAAGTAAACTTCC
AATTCTGTCTTTTTTTTTTTATAATAAAATGTGTATTTAT
CAGCTGA

hspa9 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hspa9-002 (1) 778
mRNA hspa9-201 (1) 4421
ottdart00000022285 3287
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000022285 Contained in:
OTHER ottdart00000022285 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022285 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC083504 (1) 3078bp
    GenBank:BC044175 (1) 2429bp
    GenBank:AF064831 (1) 1039bp
    GenBank:DT081447 (1) 816bp
    GenBank:DT880118 (1) 790bp
    GenBank:DT055797 (1) 776bp
    GenBank:AL731363 (1) 659bp
    GenBank:CD596539 (1) 650bp
    GenBank:BI980787 (1) 547bp
    GenBank:BG727472 (1) 530bp
    GenBank:BI474863 (1) 469bp
    CITATIONS (1)