ZFIN ID: ZDB-TSCRIPT-141209-469
Transcript Name: pmepa1-203
Previous Names: omepa1-002, pmepa1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054871 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054871|OTTDARG00000038292|ZDB-GENE-040718-320 pmepa1|OTTDARP00000043045 omepa1-002 LG_none CU855794.4,CU929078.4,FP017176.3 Danio rerio protein_coding KNOWN, 338 bp
GGACTTGAATGAGGTGCGCGCAGACGCTGGAAAGTAGTAC
AAACCGTCTGGGAATAACGGGAATACTGGAGCACAGCGGC
CAGACAGCGGGCCGGGGGCGGGGGGACGGCGGTTAGAGGA
CGGTAGACACAGAATAGGAAAAGCCTGCGTCAATGTTTTT
ATTCGACAACGCGCGCTGAGGCGACCGACTAACCAACCGA
CAAACCGTCCGTTTTTCACATCGATTTCCTCAATGTTCAG
CTTCATGGGTCTGACGAACGGAACCACCGACACCCTCGCC
AATGTCTCCTGTACATGTAACTGCCAGAGATCCACTTCAT
TCCAGAGTATGGCGATCT

pmepa1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pmepa1-202 (1) 472
pmepa1-203 338
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pmepa1-203 Contained in:
OTHER pmepa1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054871 (1)
  • Ensembl_Trans:ENSDART00000169188 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076211 (1) 1075bp
    CITATIONS (2)