header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-468
Transcript Name: opa1-202
Previous Name: ottdart00000054803

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054803 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054803|OTTDARG00000038238|ZDB-GENE-041114-7 opa1|OTTDARP00000042993 opa1-002 LG_ CT033823.9 Danio rerio protein_coding KNOWN, 1463 bp
CGCAGCTAACATATGTGTCCCATTTGGAAAGATGAATTGA
ATTTTATACTGCAAAGAGATCCTAAACTCATCTATATTTG
CCATTAGTTAATAATAGCAGGATGTTGCGAGCCGGAAGTG
TAGTTACCTGCATTGCCTGCAAGGGTTTGCTTCCCTCCAG
GATGGGGGTGAAGTTCAGAGTCCCATTGCAGAAACTGCAC
CCGCTCTCCCGTGCCATCCATCACCGCTACTCTGCTAACA
ACAACCCACAGAGACCACCTCACTGCTCAGCTGCCCGGCA
TTACACATCTCTCTCCAGGCTTCCCATGCGTCCTCCCAAA
TCACGCTCTGGAGGCCACGGCTATCAACAGCATCGGACCT
TCTGGGTGGCCCGTCTCGCCGCCAGACTGCTGAAACTGAG
GTACATCTTGCTTGGCTCAGCGGTTGGAGGTGGATACACT
GCAAAAAAGACCTATGATGAATGGAAGGAAATGCTCCCTG
ATATGAGTGAATACACATGGATTGTGCCAGACTTTGTTTG
GGAGCTGAGCGAAAATATAGATTTAGACAAGCTAGCCAGT
GCTTTACCTGAATTAGAAGAGATAGCCAAACTACTACCTG
ATATGGAGAAGATCGGAGAGAATTTCACCTTCCTGAAGAG
CCTCCTCTCCAGCGGTTTGGGTAGTGAAGTCAATGGAGCT
TCTGGTCTGCGTCTGTTATTAGAAACTACTGGCGAATCGG
CCCTAAGAGCACCAGACGTCCCACCAGCATCTGCAGCCAT
GGCTGACAGCGGAGACAAGCAGTTCAAGAAGCAGGGGCTG
CTCAGCGAACTCATTGTCATTCAGCAGCAGATCCAGCAGC
ATGAGGAGGAGATGCGGCGCGCGGCAGCCAATAACGCTCC
GCCTCCGCCCCGTGACCCCAGTCCCAGCCCGGCCCCGAAC
CCCAGCCCCTCGCAGTCCAAACGCAAGTCATCCGATAAAG
AGAAAGTTGACCAGCTTCAGGAGGAACTTCTTCGAACTCA
GTTGAAGTACCAACGGATGCTTGAGCGCTTGGAAAAGGAA
AATAAAGAATTGAGGAAAGTTGTATTGCAGAAGGATGACA
AGGGTATTCACCAAAGAAAAGTCAAGAAATCTTTGATTGA
TATGTACTCTGAGGTCCTGGACATTCTTTCAGATTATGAC
TCCAACTACAACACTCAAGATCACCTGCCAAGGGTGGTGG
TAGTTGGGGACCAGAGTGCGGGAAAGACTAGTGTGCTGGA
GATGATTGCTCAAGCTAGGATCTTTCCGAGAGGCTCTGGA
GAAATGATGACAAGGTCTCCTGTCAAGGTGACTTTGAGTG
AAGGCCCTCACCATGTAGCAATGTTTAAAGACAGCTCTCG
GGAGTTTGACCTTGGCAAAGAGGAAGATCTTGCAGCACTG
AGGCATGAGATTGAGCTCAGGATGAGGAAGAGTGTGAAGG
AAGGTCAGACAGTCAGCCCTGAG

opa1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA opa1-201 (1) 4305
opa1-202 1463
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
opa1-202 Contained in:

OTHER opa1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054803 (1)
  • Ensembl_Trans:ENSDART00000160669 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DY553169 (1) 819bp
    GenBank:EB899457 (1) 692bp
    GenBank:AF160648 (1) 670bp
    GenBank:EB773354 (1) 472bp
    CITATIONS (2)