header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-392
Transcript Name: mylk5-002
Previous Name: dkey-194j22.6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053503 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053503|OTTDARG00000037473|ZDB-GENE-050309-74 mylk5|no_translation DKEY-194J22.6-002 LG_ CU062431.6 Danio rerio protein_coding NOVEL, 410 bp
AGGAAAACACAAGCCATCAGAGAACAACGCAGGGAAATGA
CTGGGATTTTATGAAGCGGGTGTAAAACTGAAAGAAGAAA
TGAGCACTGCTGATGGAAAGACACGCTTTGTGTCCACTTT
AAGGATACAATTGTCTGGCTTCCAGCCAAATGGACAGGGG
TCTCGACCAGTCATAAAAAAGCCTGAAGACACATCAAGTG
CAGGCAATGAATGGCAATTACAACCACACAAGGCAACTGG
ATCCACCTCTTTTCACCAAGCCCCTCGAGGACTGTATAGT
AGATGAAGGAAATGACATCACATTGAACGGAAGTATCACT
GGGAGCCAGCCAATCAGCATTTCCTGGCTTCATAATGGTG
AGCCCTGTTGTTATTACTTTTAAAAATGTTCATAATACTT
ATTTTGCTAA

mylk5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mylk5-002 410
mRNA mylk5-201 (1) 3153
mylk5-203 (1) 268
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mylk5-002 Contained in:

OTHER mylk5-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053503 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK676215 (1) 410 bp
    CITATIONS (1)