header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-374
Transcript Name: ube2q1-201
Previous Name: ube2q1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053138 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053138|OTTDARG00000037282|ZDB-GENE-050522-329 ube2q1|OTTDARP00000041791 ube2q1-001 LG_ CU640433.12 Danio rerio protein_coding KNOWN, 2056 bp
CCGCACCGAACACACAGAACCCGGTTTCACCGAAACATCA
TGAAGGATTAACGGCAGATCAGCACTTTAAAACCGGCAGA
GCAGAGATCAGGAGCCCCGAGCAGCGTCCAGCCCGCTGAC
GGCTTCATTCCCGCGCTGACACTCACGTAAACACGGCCGC
AGCTGTTGTCCGCATCGCTTTTGTCCGCCGTTTGTCCGGT
TCCTGCCCGGTTTCTGCCTCCCGGAGCCCGGAGATGACCG
GAGGAAGATGTCGGTGTCGGGACTGAAGGCCGAGCTCAAG
TTTCTGGAGTCCATTTTTGACCCACATCACGAGCGCTTCA
GGATCATCGACTGGAAACCGGACGAGCTGAGCTGCCAGTT
TAACGTTACCGGAGAACAGCTGCTCATCATACACTGCAAT
ATCACGGAGTCGTACCCGTCCACGCCGCCCATATGGTTTG
TGGATTCGGATGATCCGAGTCTGACTGGAGTGCTGGAGCG
TCTGGAGGAGGTCAGGAGGGGAAGCACACTGCTCCTGCAG
CAGCTGAAGAGGCTGATCTGTGACCTGTGTCGCCTCTATA
ATCTCCCTCAGCATCCAGATGTGGAGATGCTGGACCAGCC
GCTGCCTTCAGGACATCATACACACGACAGAAAGCTGGGC
ACGACAGATGAGGTGACATCAGAGGAGGAAGAGGAGGAGG
ACATGGGAGAGGACATTGATCTGGAGCACTATGAGATGAA
AGAGGAGCCGGTGGAGGGGAAGAAGTCTGAGGATGACGGG
ATAGAGAAGGAGAATCTGGCCATCCTGGAGAAGATCCGCA
AGACCCAGCGGCAGGACCACCTCAATGGAGCTGTGTCTGG
ATCTGTTCAGGCGTCTGACCGCCTCATGAAGGAGCTGAGA
GAGATCTACCGCTCTCAGAGCTATAAAAACGGAATCTACT
CAGTGGAGCTGCTCAATGACAGTTTGTACGATTGGCACAT
CAAGCTGAGAACTGTGGATCCTGACAGTGCGTTACACAGT
GATCTGCAGGTGCTGAAGGAGAAGGAGGGAATGGACTACA
TCCTCCTCAACTTCTCCTATAAGGATAATTTCCCCTTCGA
TCCTCCATTTGTACGTGTAGTGTCTCCTGTTCTGTCTGGA
GGGTATGTACTGGGAGGAGGAGCTCTGTGTATGGAACTAC
TCACTAAACAGGGCTGGAGCAGTGCCTATTCCATCGAGTC
TGTCATAATGCAGATCAACGCCACTTTAGTCAAAGGGAAA
GCGAGAGTGCAGTTTGGAGCCAACAAGAATCAGTACAATC
TTGCCAGAGCACAGCAGTCGTATAAATCTCTGGTGCAAAT
CCACGAAAAGAACGGCTGGTACACACCACCGAAAGAAGAC
GGCTAAATGTGGAGATGGACAGAGTTTCTCCTCTGCTTTC
TCTCTTCTTCTTCTGTCTCCGTCATCCCTTCATCAGCTCT
GCAGAGATCCACCATGTTTCCACACACACCAGATCCAGTG
ACATCTGACCGCTTCTGTACATTCCTGAGTCCTGAACACA
CACACACACACACATATAGAGTTGCACTGAACTGCAGGAG
TGTGTGGATGAACATCTCTGATGATAGTGTTTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTTCTGGGATCTGCGAGGAGAC
CCATAATGCCTTAAAGAGCAGGATTGTGACTGATCTGAGA
GCAGCTCTTGTTCCTATGTTCTCCTTCACCCGTCAGCGTC
TCCTGAACCCTATGCAGTGCACTTGTTAGGGCTGATCTGT
GTTCTTCAGACAGGAGCTGTTATTCCTTCTTGACGTTTGG
ACTTCAGAGATGAAGCGTACTCAAGCCGCTCTGCTGTGCT
TCTGAATGGGAACACTGTGTGTGTGTGTGTGTTAAAGGCT
GACTCCAGATCAGTTCCTCACTCAGACGTTCACTCCTCTG
CTGTGGTTCATCTGTCGGCATGCTTCACCTTTACTGCAGT
TCCGTTTCCTCTTGTTCGGTGTCATTTTGACAGACATGTA
CAGAACCGTTTGTAAACTTGCATCAAGTTTATGAATAAAG
AATTTTAAGAAATGCA

ube2q1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ube2q1-201 2074
ube2q1-202 (1)    Ensembl 1313
ube2q1-203 (1)    Ensembl 717
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ube2q1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000053138 (1),  Ensembl_Trans:ENSDART00000159481 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC154266 (1) 1869 bp
GenBank:GO935301 (1) 875 bp
CITATIONS (2)