ZFIN ID: ZDB-TSCRIPT-141209-3554
Transcript Name: si:dkey-219e21.2-201
Previous Names: dkey-219e21.2-001, si:dkey-219e21.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061914 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061914|OTTDARG00000042843|ZDB-GENE-141215-26 si:dkey-219e21.2|OTTDARP00000048421 DKEY-219E21.2-001 LG_ CR848021.10 Danio rerio protein_coding NOVEL, 1926 bp
AGTCTCAGCAGACACCTCGAGCTGCGTTCACCTGCTCCCC
AACACCTCACCATGGGAGAACAGACGAAGCCCTACAAGAG
CATCCTGAAGGACAACACTCTAAAAGTGCCTCAGATCTCC
AACCAGGGGCAGCAGAGTAACTCTATTGGCGCCGTGCGAT
GGGTTTTACCGGATGAAGAGGTTCAGGTACACAGCTCCGC
GCCCACGATCCCCTACAAGAGTAACAGCGGCTTCTCCACT
CGCTCACAGCAAAGGCAGCGTCAGCAGGGCCTTAAGGACC
TCCGCAGCTTGGACGAGTGCATTCAGTTCATCAACCGCTG
GAAACAGCAGGTGGCACAAGTCTGCAAGAATGAGGACGAT
CCCGGTGAAGGAAGCAGCAGACCAACAAAAACAGACTCCA
GAACTGAACGCAGTCTTGAAGAGAGTCGCAAGCTTATTCT
TCAGTGGGCCAATGAACTTCAAAGTGTAGACAAGCTATCC
AAAAAGCAGCCATGGTTGAAGGAAAGGATTGATCTGGAGG
AAGAAGATGACAAAACTAAGCTTGATAAAAGTGAGGGTGA
TGAGGTGCAGGAGAGGATCACAGAATGGGCCAAAGAGATA
CAGAGTGTGTCAGAGAGCTGCGGTATGCCGGGAGATGAAC
TGGCGCAGATGTTGCGTCTGCTGGGACTAAGGAAAAAGAG
ACTGGCTACCCTCATGCCACTTCTGGAGTTCATCACATGG
AGTCTGCTGAAAGAAGAGAGCAAGGGCATGGTTCCTCATC
TTTGGCTTTCTGCTAAGCAGCGCACCTGGAAAGCTGGAAT
ATCACGATACATCCCTAATTCAGTGTGGAGCTGGATTGTC
AGTGCAGGAGCTGATGTAAGTCTTGATCCCATGACCAACA
ACCCTTGGCTTTATGTTTCTGAAGACCACAAGAAGATTCA
GGAGGGTCTAATAGAGGCCAATCTGCCTTACAGCTCTCAG
CGCTTTGATAGTTTGCCCTGCGTGCTAGGTTGGGAAGGCT
ACATGAGCGGCCGCCATTACTGGGAAGTGGAGTTTGCAAA
TAATGGTTATTGGAGAGTAGGAGTGACTACTGCCTCCTCA
AAGAGGCACGGCCGCTTCCCGATGAACCCATCAAGTGGTT
ATTGGGTCCTGTGGCGGAGCACAAGACAGTTCTTCGCCTG
CACCAATCCTGAAACCCCCCTGCCACAGGAGCTGGTGCCC
CGGAGAATGGGAATATACATTGACTATGAGGAGGGACAGA
TCTCTTTCTACAATGCCGACAACAAATCACACATTTACAC
TTTCACTGGACACTTTCGCGAAAAGCTGTACCCTTTCTTT
TCTCTCATGGATGGCAGGACCCTTATGACCTTATGGTCTC
CTAAAGAGCATAGCCACTTTTAATAGCATGGCAGGTTTAA
AAGTTTATCTTTCACTCTGCACTTTCACTCATTTGAACAT
TTACACCTTAATAAATGATTCATTGGAATCAATTTAATCC
AAAAGAAATAATAGCAGCCTTTCCATTTAGAGGATTGAAC
ACCATTGTGGGCTGGACCCACTTAATAAAGGCTATTATTA
AAAATAACAAATGAAACACTCTTTCAACATGATTGCCATA
TTAATATTTCCTATTTAGAATATTTATATGTATATTTTAT
GTCGATCTATAATTATATACATGCATCTCAGCTTGTCTGC
TTTCATGTATATGAATAACAGTATGTGTTATGACACAAAT
ATTTCATGAAATATAAATTGCATAATGTTGGTATGTATAT
ATTTCTATATAAAGTGTTGTCTGTTAATTCGTGTAACATT
GAATAAGATAACTACAATGTGATATTTATTATATTAATGT
GTATATGTTGTTATTAAAAGGTTAATCATTCTGTATTATA
GATGCTCTGGATGATTATGTATTAATAAAAAAAATTAATT
CAGGTC

si:dkey-219e21.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-219e21.2-201 1926
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-219e21.2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061914 (1),  Ensembl_Trans:ENSDART00000153112 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE703761 (1) 763 nt
GenBank:EH485765 (1) 413 nt
GenBank:EH512183 (1) 396 nt
CITATIONS (2)