header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-3311
Transcript Name: cdk2-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061122 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061122|OTTDARG00000042360|ZDB-GENE-040426-2741 cdk2|no_translation cdk2-002 LG_ CU633767.5 Danio rerio protein_coding KNOWN, 751 bp
GCGGGAACTGGCGGCGGTATTGATATTAAGTTCTGACAAG
AGTTTCAGTCGCCCGTTTTAACGTATCAAATAAACAATTT
TAATGTTTTTGATCGCCGGTTTGCATCGAATAGCACTTTC
TCTGCACAGCTGCTCTTTTAAATAGATCCAGAGTGACGGT
TTTCCCCGGAAAAGGGGCACTTTTGACATGGAGTCTTTTC
AGAAAGTGGAGAAGATCGGAGAGGGAACATACGGAGTGGT
TTATAAAGCCAAAAATAAAGTTACAGGAGAAACTGTCGCG
CTGAAGAAAATCCGATTAGATACGGAAACTGAAGGTGTTC
CCAGCACTGCCATTCGTGAGATCTCTCTGCTAAAAGAGCT
CAATCACCCTAACATAGTCAAGTATGTGCACTGTTTATGA
ATTTAGTCTCAAAACCAGTGAATATTTCAATGCACAAATG
TCCTCCTGGTTTGTGAGTTTTACAGTTTTCTTGCCTCCAG
GTTGCGTGATGTGATACACACTGAAAATAAACTTTACTTG
GTGTTTGAGTTTCTTCACCAAGACCTGAAGAGGTTTATGG
ACTCGACGTCTGTCAGTGGCATATCCTTGCCACTCGTGAA
GAGTTACCTATTCCAGCTGCTCCAGGGATTGGCCTTCTGT
CACTCCCATCGGGTTCTTCACAGAGATCTTAAACCCCAGA
ATCTCCTCATCAACGCTCAGGGCGAGATCAAACTGGCTGA
CTTTGGTTTGGCCAGAGCGTTCGGTGTACCT

cdk2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cdk2-002 751
mRNA cdk2-201 (1) 1734
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk2-002 Contained in:
[Fosmid] CH1073-182B19 (1) (order this)

OTHER cdk2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061122 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CB366388 (1) 520 bp
    GenBank:AL717953 (1) 510 bp
    GenBank:EB786333 (1) 468 bp
    CITATIONS (1)