ZFIN ID: ZDB-TSCRIPT-141209-3310
Transcript Name: pmela-202
Previous Name: pmela-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061119 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061119|OTTDARG00000042358|ZDB-GENE-030131-9818 pmela|OTTDARP00000047303 pmela-001 LG_ CU695201.6 Danio rerio protein_coding NOVEL, 3163 bp
GGGGGGCTGATATTGAAGAGCGTGCGGGATCTCGGGTCTC
TGGAGGAAATCTCTTCATCAGTGCTGGTGTGGTCATCAGT
GCACGCGGTCATCATGTGGACATCTCTCATCTTCCTCATC
CTCAGCCTCGCATCAGGAGCTCTTTCACAATCCCGAACTC
GATTTGCACGTTATCGTTCATGGAATTCACAGATGTATCC
GGTCTGGAGGGACGGAGATCCCAGATACAGAGACTGCTGG
AAGGGTGGCGAGGTGACAATTGAAGTCAGAAGTGATTCTC
CAACACTGACTGGAGCAAAAGCCTCTTTCAACATCGATGT
TCGTTTCCCGCAGAACCAGACGGTTCTCCCTGATGGACAG
GTGGTGTGGGCCAGAAACTGCACTGTAAATGGAACATCAT
ATACTATGGGCCAGTCTGTGTATCCTGAATCCAGTATCCC
TCAAGACTGGAGCGGCGTTTTTCCTGACAGGACACCCTTC
AACAGGACCTCCAACAAAAAGCCACGCTTCATCTATGTGT
GGAAAACATGGGGAAAATACTGGCAGGTGGCTGATGGTCC
TTCTTCTCTGCTGAGCATTGACACAAACAGCGTGCCTCTT
GGTTCTTACAGCATGGAAGTGGTGATTTACCACTGCCGCG
GCAAAGACAAGTTCATTCCCCTTGGTTATGTATCCACTCA
GTTCTCCATCACTGACCAAATTCCCTTTGCAGTGACTTTG
TCCCAAGTTGGTGACATCAACCAGGGTGACCAAAACTTTA
TCCAGAACCGAGCCGTGGCCTTCAGCATTAATCTGCACGA
CCCCAGCAGTTATCTCAGCAGCTCAGACATCACCTTCAAC
TGGGATTTCGGTGACAATAGTGGCACTCTGATCTCTCGGG
AAACTACCGTAACCCACACATACCTCACGCCCGGATCCTT
CAGGCCACAGGTGATTTTGATGGCCGCCATCTCTACTGGT
TGCCCAGTCAATCCAACTCCAGCAGTCACCGTTGATCCTC
CTGCTCCAGTTACAGATGAAGGTACAGCACTGGATACCAT
TGTGGTCGCAGTTTCTCCTCAACCAGTTGATGTCATTCCC
AATGCAGAGGAGGGAGTTGCAGCCAACGCCACTGTTGTTG
CTAATGACTTAGCAGTGGCAGAAACTGATCCAGTTGACCC
AGCAGACACTGTTGACACAACTGATGCTGTGGCTGAAGCC
GACAATACTGCTGTGGTTGAAGGAACTGTAGCTACTGAGG
CTGAACTTGCGGCTGAAGCTGAAAACACTGCTACAGATGC
ATTAGCTACACCTGCAGTTATAGAAGCCGAAGCTGCAGCC
GAAGCTGAAAACACTGCTACAGATGCATTAGCTACACCTG
CAGTTATAGAAGCCGAAGCTGCAGCCGAAGCTGAAAACAC
TGCTACAGATGCATTAGCTACACCTGCAGTTATTGAAGCC
GAAGCTGCAGCCGAAGCTGAAAACACTGCTACAGATGCAT
TAGCTACACCTGCAGTTATTGAAGCCGAACCTGCAGCCGA
AGCTGAAAACACTGCTACAGATGCATTAGCTACACCTGCA
GTTATTGAAGCCGAACCTGCAGCCGAAGCTGAAAACACTG
CTACAGATGCATTAGCTACACCTGCGGTTACTGAAGCCGA
ACCTGCAGTCGAAGCTCCAGCAGCTGAGATCGATCTGGCA
GCCACGGTTCTCCCAGAAGCCGCTGCTGCAGCGGTCGACA
CCACCTCAGTCCAGACGGCTCTTGAACCAGTGGCCCCGAC
TGGAGATGCAGTGGTCGCTAATGTTGCAGAAGACACAGTT
ATCGAAGCCGCTGCTGAAGCCGATGACGCAGCCAACGCAA
TCACTGGTGTAACTAGCATCCCTGAGGCAGCAGTGACCGA
GTTGGAAGCCGAATTGGTGGCAGGAACTGAAGCAACTCAG
GCCGCACTAATCATTGCAAAGCGGCAAGCACCAGAAATGC
CAGCAGAAGCTAGCTGTATGGTTTATCGTTATGGATCCTT
CTCTACTACTCTTACAGTTGTCCAGGGGATAGAGAGTGTT
GAGATTGTGGAGGTGAATAATGTGGTGATGCTGGCCACAG
AGCTGGAGCAGAACGCGGTGGATCTCACAGTCACATGTCA
GGGAAGTCTCCCAAATCAAGTGTGCACCGTGGTGTCAGAC
GCAGACTGCATCAGCCCAGTTCAGACCCAGTGTAATGACG
TGACTCCGACCCCCGAGTGTCAGATTGTGCTCAGACAGTT
TTTCAACAACTCCGGCACCTTCTGCATCAACGTGTCTCTG
ACCAACGACGTCAGCTTGGCTGTGACCAGCGCACGGCTCA
ATGTGGCTATAGGCAAACACAAACTCATCGAGGAACACGG
CTGGAGCGACACTCGGAGTTCTGTTTTTCGTTTGTGCTTT
GGCGGCCATTGCTTTTACATACAAGCGGTTTAAGGAGTAC
CATCCACTGAGAGAAGAAAGCGAGGGCAGCGGTTTTGCTT
CAGGAATAAGCGCAGTACCTTCGATGCTGTGGAGCTTTCT
GAACCGGAGATCGACTGCCGAGAGCCGTCCACTTCTGCTG
GGACGCGTGGTGTGAAAACAGCCATAATGCATCACCTGTA
CAGTCTCTTGATAAGAAAATTTAACAAGCCTATTAACAAG
AGGTCCTTATTGTACTGTAATAACAATGTCATGTGCAAAA
ATATCATATGCAGCATGAATCGAGTAATCCAAATAAAGTA
TGGTGGTTGCACATGTTGTAAAAACAGATACTTCTGCTTT
ATTTGGTCTACAGTCACACTACAAAAAATGCTTCATGTAC
TGTTTTTATAATTGCTTTAGTCCAAATATCTAAAAAATCT
TAAATCTAAAGCATTTTCATGCAAGGAAAAACTTTTTTTT
CTGAAAACAAGCTAAATAATCTTTAATGTTTATTTTGCTC
ATTTTACTAATAATCTTGTGTATTTTTGACATTTGTTTAT
TTTTTTTCAGACAGACCTTTTTTTTTTGTCTAGAACAGAG
ATGCCCAAACTAGGGCCAAAGTTGGCCCATGGTAACCTTT
GATTTGGCCCGCCATCCCATCTGAGAATAGAGGAAGAATG
TTTAGAGATTGTCTTTTTAAATGTAATGTAATCTTTTGTT
TGTTTGTTAAAAGCTAATTGAAAATAAATGTTTTAATTAA
ATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pmela-202 Contained in:
OTHER pmela-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061119 (1)
  • Ensembl_Trans:ENSDART00000159459 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129133 (1) 3153bp
    GenBank:BC117628 (1) 2708bp
    GenBank:BC163450 (1) 2702bp
    GenBank:EH587627 (1) 893bp
    GenBank:CO934332 (1) 874bp
    GenBank:CN502635 (1) 852bp
    GenBank:EH605076 (1) 801bp
    GenBank:BI883053 (1) 542bp
    GenBank:EB799017 (1) 435bp
    GenBank:AW076688 (1) 412bp
    GenBank:AI601784 (1) 380bp
    CITATIONS (2)