header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-30
Transcript Name: tnksb-201
Previous Names: tnksb-001, ch211-155m12.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018946 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018946|OTTDARG00000015800|ZDB-GENE-030131-4865 si:ch211-155m12.3|OTTDARP00000015988 CH211-155M12.3-001 LG_ AL928901.8 Danio rerio protein_coding NOVEL, 4216 bp
ACTGAACGGAAGCGCTGCGGCTCCAGCTGTTATTGTTGAC
AGACGGAGCTTCGGGGGGAAAATGGCGGTGTCCCGTCGAT
CCTCACAGCACCAACAAAGCAGCCTACAACCGTCTCCGCG
AAACGCCGTAATCGCTTCCCCTCCTCCTGAATCGCCGTCC
GCTATTATTCCCGATTCCGCGAGTTTATTGAGCCCTTCAG
CCACTGGCGCAGCAGAATGTGGCGCATCGACGATGGAGTC
CGCAGCGGCCTCCTCCGCCTCCGCCTCTTCCCCAGACCGG
CCCGCCCCGGTAACAGCAGCGGCCGCGGGGGGACCGTCAG
TCCTCGGCAGCTCCAGCTGTAGCAGCATTAGCTCCAGCGC
GACCGCGGGCAGCCAGAGCCCCGGATCCGGAGCCGCCAGT
CCCGGGGAGGCGGTGTGCGGGGCTGGCGGGGCGTTCAGGG
AGCTGTTCGAGGCCTGTCGGAATGGAGATGTGTCGCGGGT
GAAGAGGCTGGTGGACTCGGTGAATGTGAACGCTAAAGAC
ATGGCCGGACGAAAATCAACCCCTCTGCATTTCGCTGCAG
GCTTCGGCAGAAAGGATGTTGTCGAGCATCTCCTGCAAAC
CGGAGCCAACGTTCATTCCCGTGATGATGGTGGTCTGATC
CCGCTCCATAACGCTTGCTCATTCGGCCACGCAGAAGTGG
TCAGCCTGCTGTTGTGTAGCGGCGCCGACCCCAACGCTCG
AGACAACTGGAACTACACACCTCTGCATGAGGCCGCCATC
AAAGGCAAAATAGACGTCTGCATCGTGTTGCTTCAGCACG
GTGCTGATCCAAATATCAGAAACACTGACGGCAAATCAGC
TCTGGATCTGGCAGACCCTTCTGCTAAGACCGTCCTCACT
GGTGAATATAAGAAGGATGAACTATTGGAAGCAGCGAGGA
GCGGAAATGAGGAAAAACTGATGGCACTTTTGACCCCGCT
TAACGTCAACTGTCATGCCAGTGATGGACGCAAGTCCACT
CCTCTCCACCTGGCCGCTGGGTATAATCGTGTGCGTATCG
TGCAGTTATTGCTGCAGTACGGTGCAGATGTCCATGCCAA
AGACAAAGGTGGTTTGGTTCCTCTGCATAATGCCTGTTCT
TATGGTCACTATGAGGTCACAGAACTCCTGCTGAAGCATG
GGGCGTGTGTTAATGCCATGGACCTCTGGCAGTTCACGCC
GCTGCACGAGGCGGCCAGTAAGAATCGAGTGGAGGTTTGT
TCTCTGCTGCTGAGTCACGGCGCAGATCCAACACTGCTGA
ACTGCCACGGCAAGAGTGCGGTGGATGTGGCTCCCACACC
TGAGCTGAAAGAGAGACTCACCTATGAATTTAAAGGACAC
TCGCTTCTGCAAGCGGCCCGTGAGGCGGACATGGCGAAGG
TCAAGAAAACAGCTCAAGAAATCATCAGCTTCAAACACCC
GCACTCGCACGACTCCGCTCTGCACTGCGCCGTAGCCTCT
CCTCATCCCAAACGCAAACAGGTCACAGAGTTACTGCTGA
GGAAAGGTGCCAACATTCACGAGAAGAACAAGGATTTCAT
GACCCCGTTTCACGTAGCAGCTGAACGAGGTCATAATGAT
GTGCTTGAAGTCCTGCAGAAACACGGAGCAAAGGTGAACG
CTGCGGACACACTGGGTCAGACGGCTCTGCACAGGGCTGC
TCTTGCTGGTCACATCCAGACCTGCAGATTACTGCTGAGT
TACGGAGCAGATCCTTCAATCGTCTCACTGCAGGGCTTCA
CTGCATCACAGATGGGGAATGAAGCCGTTCAGCAAATACT
CAATGAGAACGTTCCTCCCCGTAATTCAGATGTGGATTAC
CGCTTGCTCGAAGCTGCTAAAGCTGGCGACCTTGATACAG
TGAAGCAACTGTGCTCTCCTCAGAACGTGAACTGTCGGGA
TCTGGAGGGCCGTCACTCTACACCGCTACACTTCGCCGCA
GGCTACAACCGGGTGGCTGTGGTGGAGTATCTGCTCCATC
ACGGGGCCGATGTGCACGCTAAAGATAAAGGGGGTCTGGT
TCCTCTGCACAACGCATGCTCGTATGGTCACTACGAGGTG
GCGGAGCTGCTGGTGAGACATGGAGCATCTGTGAACGTGG
CCGATCTCTGGAAGTTCACACCACTACATGAGGCTGCAGC
AAAGGGCAAATACGAGATCTGCAAACTACTGCTCAAGCAT
GGTGCAGACCCGTCTAAGAAGAACCGTGATGGTAACATGG
CTCTGGACATGGTGAAAGATGGAGACACGGACATTCAAGA
CCTGCTGCGTGGAGACGCCGCTCTGCTGGACGCTGCCAAG
AAGGGCTGTTTGGCCCGAGTGCAGAAACTCTGCAGCCCGG
AGAACATCAACTGCAGAGACACACAGGGCAGGAACTCCAC
ACCGCTGCACCTTGCGGCTGGCTATAATAACTTGGAGGTG
GCCGAGTATCTCCTGGAGCATGGAGCGGATGTGAACGCTC
AGGATAAAGGAGGACTGATTCCTCTGCATAATGCTGCTTC
ATATGGGCATGTGGACATCGCCGCCCTGCTGATCAAGTTC
AACACGTGTGTAAATGCGACAGATAAGTGGGCCTTCACTC
CTTTGCATGAAGCTGCTCAGAAGGGCCGAACACAGCTGTG
TGCACTGCTACTGGCACATGGTGCAAACCCCACCATGAAG
AATCAAGAGGGACAGACTGCTCTGGACCTCGCCACGGCTG
ATGACATCCGTGCTCTGCTGATGGATGCGATGCCCCCTGA
TGCCCTGCCTAGCTGTTTCAAACCGCAGGCCACCGTGCTC
AGCGCCGCGCTCATTTCTCCCGCCTCCACACCCTCCTGCC
TCTCCGCCGCCTCCAGCATCGACAACCTGGCTGGACCTCT
ATGTGACGGAGCCAGTGGAGGAGCCGCGGGACCCGCTGAT
GGAGCCTCCAGCACTGATCGCAAAGAAGGAGATGCTGTCC
TGGATATGAACATCTCCCAGTTCCTGAAGAGTTTAGGCCT
TGAACATTTGAGGGACATCTTTGAGAGAGAACAGATCACC
CTGGACGTATTGGCTGATATGGGTCATGAGGAACTCAAGG
AGATAGGAATCAACGCTTACGGACACCGTCATAAACTCAT
TAAAGGCATTGAGAGGCTGCTGGGAGGACAGCAGGGTGCC
AATCCATACCTGACGTTCCACTGCACCAATCAGGGCACAG
TATTGATTGACCTGGCTGTGGATGATAAGGAGTTTCAGTC
CGTTGAGGAAGAGATGCAAAGCACAATTCGGGAACACAGG
GATGGCGGAAATGCAGGTGGCGTTTTCAGTCGTTACAATG
TCATTAAGATCCAGAAGGTGGTGAATAAGAAACTGAGAGA
ACGATACACACACAGGCAGAAAGAGATCGCGGACGAGAAT
CACAATCACCACAATGAGCGAATGCTGTTTCACGGATCTC
CGTTTATAAACGCCATCATCCATAAAGGCTTTGATGAGCG
TCATGCGTATATCGGCGGCATGTTTGGAGCGGGTATATAT
TTTGCAGAGAACTCTTCAAAGAGTAACCAGTACGTCTACG
GCATCGGTGGTGGTACAGGATGCCCAACTCACAAGGATCG
TTCCTGTTACCTGTGCCACAGGCAAATGTTGTTCTGCCGT
GTGACATTGGGAAAATCCTTCTTGCAGTTCAGTGCCATGA
AGATGGCCCACGCTCCGCCTGGGCACCACTCTGTGATCGG
CCGTCCCAGTGTCAACGGCCTGGCCTACGCAGAGTATGTG
ATCTATCGCGGAGAACAGGCCTACCCAGAGTATCTCATCA
CCTATCAGATAATGAAGCCGGACAGCACGCCTCAGTCCTC
CACAGGAGCGGAGCAGAAATCATAGTCAGCAACACTGCAT
TCACTCACTCACTCATTGACTCACTCACTCATTCTTTCTC
ACTCTCTCGTTGCACAAAGGAAATGTGAACTTTCCCATGT
ACCCACGTCTTACCCATGAAATTCCCCATGTATGAATTAT
GAATTTGCACTTTTAAAAGAAACAAAACAAGTTACTTAAG
TTATTTGAAAATAGTCGCAATTGTGAAGTCTAATGTACAG
GTAGTATAAAGAAAACGTGTAAAACTGACTGTGTTTAACG
ATGCTATTTGAGTTGTATTTTAATGGAACTTTGTTTTTTT
GCTTTTTGTTTTGGAGTCTGTTAAATTTCTTTTAAATAAA
TCTCATCAGAACAGGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tnksb-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018946 (1),  Ensembl_Trans:ENSDART00000091397 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH591204 (1) 911 bp
GenBank:CK029465 (1) 787 bp
GenBank:CK028164 (1) 772 bp
GenBank:CK027002 (1) 738 bp
GenBank:BQ618721 (1) 587 bp
GenBank:BM071471 (1) 568 bp
GenBank:BI883603 (1) 507 bp
GenBank:BI883544 (1) 504 bp
CITATIONS (2)