header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2946
Transcript Name: mpp7b-201
Previous Names: mpp7b-001, ch1073-344g18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058895 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058895|OTTDARG00000040829|ZDB-GENE-141212-293 mpp7b|OTTDARP00000045993 CH1073-344G18.1-001 LG_ FP102784.3 Danio rerio protein_coding PUTATIVE, 714 bp
CTAGCAGAAGAGCTGCAGGATACAGTCAACAGTCCAGAGA
CAACAGAGCTGTTAAACCTGCTTTCCAAACCTCATGTACA
GACTCTTCTGTTAGTGCATGATGTGGTGGCGCAGAAAAGG
TTTGACCCTCGGTTGCCGCCTCTGCCCCCTTTACCTGATT
GCAACGAGGAAGATGAAGATTCAATCAAGATTGTTTGCCT
GGTTAAAAACCAAGAGCCACTGGGAGCCACCATAAAGAGA
GACGAGTCGTCTGGAGCTATAATCGTGGCTCGGGTCATGA
GAGGAGGAGCTGCTGATAGAAGTGGTCTGATTCATGAAGG
TGACATGCTCAAGGAAGTCAATGGTGTTCCAGTGGAGGAC
AAAAACCTACAGGAGATCATCCCAATACTGGCCAAGTCAG
AAGGAGCGGTGACCTTTAAAGTCGTCCCAGGCACCAATGA
AGAGCTGGAGACGAACGACACCCAGGTCTTCGTGAGAGCC
CTTTTTGACTATGATCCCCAAGCAGATCCTGCTATTCCAT
GCAGAGACGCTGGGTTGGAGTTCCAGAGAGGAGATGTTTT
GCAGATTGTGAGCCAAGATGATGACACCTGGTGGCAGGCC
AGACGGCACGGAGACGCCAACCTCAGGGCCGGACTCATTC
CCTCAAGACAGCTTCAGGAAAGGAGAGTGATGTTACAGAG
GCCTGAAGTTTTGTTCCACTCACCCAGAGTTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mpp7b-201 Contained in:
[Fosmid] CH1073-344G18 (1) (order this)
OTHER mpp7b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058895 (1)
  • Ensembl_Trans:ENSDART00000081897 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)