header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2916
Transcript Name: opa1-201
Previous Name: ottdart00000054802

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054802 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054802|OTTDARG00000038238|ZDB-GENE-041114-7 opa1|OTTDARP00000042992 opa1-001 LG_ CT033823.9 Danio rerio protein_coding KNOWN, 4305 bp
GCAGCACTTGACACTAGCGATCGCCTGCTTGTGATGCCCT
TGTTAGCCACGCAGCTAACATATGTGTCCCATTTGGAAAG
ATGAATTGAATTTTATACTGCAAAGAGATCCTAAACTCAT
CTATATTTGCCATTAGTTAATAATAGCAGGATGTTGCGAG
CCGGAAGTGTAGTTACCTGCATTGCCTGCAAGGGTTTGCT
TCCCTCCAGGATGGGGGTGAAGTTCAGAGTCCCATTGCAG
AAACTGCACCCGCTCTCCCGTGCCATCCATCACCGCTACT
CTGCTAACAACAACCCACAGAGACCACCTCACTGCTCAGC
TGCCCGGCATTACACATCTCTCTCCAGGCTTCCCATGCGT
CCTCCCAAATCACGCTCTGGAGGCCACGGCTATCAACAGC
ATCGGACCTTCTGGGTGGCCCGTCTCGCCGCCAGACTGCT
GAAACTGAGGTACATCTTGCTTGGCTCAGCGGTTGGAGGT
GGATACACTGCAAAAAAGACCTATGATGAATGGAAGGAAA
TGCTCCCTGATATGAGTGAATACACATGGATTGTGCCAGA
CTTTGTTTGGGAGCTGAGCGAAAATATAGATTTAGACAAG
CTAGCCAGTGCTTTACCTGAATTAGAAGAGATAGCCAAAC
TACTACCTGATATGGAGAAGATCGGAGAGAATTTCACCTT
CCTGAAGAGCCTCCTCTCCAGCGAAACTACTGGCGAATCG
GCCCTAAGAGCACCAGACGTCCCACCAGCATCTGCAGCCA
TGGCTGACAGCGGAGACAAGCAGTTCAAGAAGTCATCCGA
TAAAGAGAAAGTTGACCAGCTTCAGGAGGAACTTCTTCGA
ACTCAGTTGAAGTACCAACGGATGCTTGAGCGCTTGGAAA
AGGAAAATAAAGAATTGAGGAAAGTTGTATTGCAGAAGGA
TGACAAGGGTATTCACCAAAGAAAAGTCAAGAAATCTTTG
ATTGATATGTACTCTGAGGTCCTGGACATTCTTTCAGATT
ATGACTCCAACTACAACACTCAAGATCACCTGCCAAGGGT
GGTGGTAGTTGGGGACCAGAGTGCGGGAAAGACTAGTGTG
CTGGAGATGATTGCTCAAGCTAGGATCTTTCCGAGAGGCT
CTGGAGAAATGATGACAAGGTCTCCTGTCAAGGTGACTTT
GAGTGAAGGCCCTCACCATGTAGCAATGTTTAAAGACAGC
TCTCGGGAGTTTGACCTTGGCAAAGAGGAAGATCTTGCAG
CACTGAGGCATGAGATTGAGCTCAGGATGAGGAAGAGTGT
GAAGGAAGGTCAGACAGTCAGCCCTGAGACCATCTCTTTA
AGTGTTAAGGGCCCTGGAATCCAGCGAATGGTGCTTGTAG
ATTTACCAGGGGTCATCAGTACTGTGACAACTGGAATGGC
CGCAGACACAAAGGAAACCATTTTTAGCATTAGTAAAGCT
TACATGCAGAATCCAAACGCCATCATCCTCTGTATACAGG
ATGGCTCAGTAGATGCAGAGCGCAGTATAGTCACTGATCT
GGTCAGTCAAATGGACCCTCAGGGCAAAAGGACCATATTT
GTTCTTACTAAGGTTGATCTGGCAGAAAAGAACCTGGCTA
GTCCAAGCAGAATCCAGCAAATAGTAGAAGGCAAATTATT
CCCAATGAAGGCTTTGGGCTACTTTGCTGTAGTAACTGGC
AAAGGCAGCCCTAATGAGAGCATAGATTCCATTAAAGACT
ATGAGGAGGACTTCTTCCAGAACTCAAGACTGCTGAAGGA
TGGCATGTTGAAAGCTCATCAGGTGACTACAAAGAACCTG
AGTCTTGCTGTGTCAGACTGTTTCTGGAAAATGGTCAGAG
AGTCAGTAGAGCAACAAGCAGATGCCTTTAAAGCTTCTCG
ATTTAACCTGGAGACTGAGTGGAAGAACAACTATCCTCGC
TTACGAGAGCTGGACAGGAACGAGCTCTACGAGAAGGCCA
AAAATGAGATCTTGGATGAGGTGATCAGCTTGAGTCAAGT
TACACCAAAACACTGGGAGTCTATCTTACAGAAGAAGCTT
TGGGAAAGAGTCTCGACACACGTCATAGAGAACATCTACC
TGCCTGCTGCACAGACCATGAACTCTGGAACTTTTAACAC
CACTGTAGACATCAAACTCAAGCAATGGACTGATAAACAA
CTTCCTCATAAAGCACTAGAGGTTGCTTGGGAGACTTTGC
AGGAAGAGTTTGCCCGCTTCATGGCCGAATACAAAGGGAA
AGACCAGGATGACATTTTTGACAAGCTGAAGGAAGCTGTC
AAGGACGAGAGCATCAAACGACACAAGTGGAATGAAAGAG
CCATGGACAGCTTGAGAGTGATTCAACACAACGCTCTGGA
GGATCGTTCAATCACAGACAAGCCCCAGTGGGATGCCGCT
ATACAGTTCATGGAGGAAACGCTGCAGTCTCGTCTTAAAG
ACACTGAGTCAGTAATAGCTGATATGGTGGGGCCAGACTG
GAAGCAGAGGTGGATGAGCTGGAAAAACCGAACACCAGAG
CAGCACACCCGGAATGAAACCAAAAATGAGCTGGAGCGTC
TGCTGAAACTGCATGAGGATCACACAGCATATTTGGCCAA
TGATGAGGTCACTACAGTGCGCAAAAACCTGGAGGCCCGA
GGGGTGGAGGTGGACCCTGTATTGATTAAGGACACATGGC
ATCAGCTCTTTCGACGTCACTTCCTACAGAAGGCACTACT
ACATTGCAACCTCTGCAGACGAGGTTTCTACTACTATCAG
AGGCACTTCGTAGACTCTGAGCTTGAGTGCAATGATGTGG
TTCTGTTCTGGAGGATTCAGAGGATGTTGGGCATCACTGC
CAATACTCTTCGACAACAGCTCACTAACACTGAGGTACGG
CGTTTGGAGAAGAACGTTAAAGAAGTATTAGAAGACTTTG
GAGAGGACAATGAGAAAAAAGTCCAGCTGATCACAGGCAG
GAGGGTTCAACTGGCAGAAGACCTCAAAAAAGTTCGCGAA
ATTCAGGAGAAACTTGAAGCCTTCATTGAAGCTCTTCACA
AAGAGAAGTAGAGCAGATCATCTTGTTTCTGGGCAGACAG
ACAGGCAGACATGCTCTTACACAAGAAAATGCACTGATCA
AAAACCATCATTTTTTCCTCTTTGCTCCTTTGCAAAGGAC
TTTCCTTCCAACTTCTTCTGTTTTTAACAGCTCCTGTTGT
ATGTTCTCACAAAACACACACACAAACACACACACACACA
CACTCTTCCCTCTTTAAAACAGTGAAAATAAGTGAACTAA
GCTGGAGTCCCTTTACATTTACTGCATATTTATTAATTTT
GGACAAAAAGCACTTACTCTGCTATCAGAATAATGGTACA
CATTGCAGTGCCATGCTTTATTCTTTCTTCACTCAAAGCT
TCAAAAAACAATATTTGCACCAGAGAAACCATTCAGACAG
GCATACACAACCATAATCTCTCATCCTCTGTTCCCAATAA
ATGACTTGCTCCAGGTCTCTCTTTCCCCTGACTTTCTTTA
TTATTTAAGGTGACATTTTATGGATAAGTGCTAAATGCTA
AAACGCATCTTTACTGATTGGCCTTGATAGAGAAATTGTT
CTAAAATGTTTTCTCACCAGAAGCTGCGATTTCATATCTC
ATTGCCATCACAAGTCACAGATCTTTTTGTTTTCCTTCAC
CTAAAAATTATGTTTTGTAATTATGTAGAATCCTCTATTA
ATATATGCAGATGTTTGTTACCGTTTTTGCTACTTGTAGT
CCCATTTAGCTCAGTTTATTATGTTTAATAAACTGTGATT
GGCTTGATCTTGAAGATGCAAAGTTATGGATACATTAACC
GCATTATATCATCTGCTGGATGAAAACTTGTTCAATACTT
TTGTTCCTAACATCATTTTCATTTCATTTCTTTTGCTACT
TTGAATGGTTCTTATTTTTCATCTGCCATCTTCAACTATA
GTGCACTTTTATTTTTTGCTTGCACATTTTATATCTCGCT
CCCTGGATTTGATATGAAATCCACTTTAATATCCTGATAA
TTTCGAGTGTAAGAGATGCCACAACTCAATGTAAATGGTA
AATATATTTGTAAAGTCTCCGTAGAGTAAGTTCATTCAAA
TGATGAATCTGTTGTCACAAGGGGAAATATATGAGTGTGG
TGCTTGTAGCAAAGTAGATGTCGGTTCATTTAAGAATGCT
TCCCCTATTTGCTGTAGATTGTAATGTTTGCATGTTGTAT
CCCATCCGATGTGGTTTATTTATTAAATTGGTGTTAAAGA
AAAGAAGAATAAAAGTGACTTTAAA

opa1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA opa1-201 4305
opa1-202 (1) 1463
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
opa1-201 Contained in:

OTHER opa1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054802 (1)
  • Ensembl_Trans:ENSDART00000104256 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC085633 (1) 4296bp
    GenBank:EE713503 (1) 918bp
    GenBank:EE311739 (1) 914bp
    GenBank:DT055102 (1) 731bp
    GenBank:FP159635 (1) 622bp
    GenBank:CK691625 (1) 595bp
    GenBank:BE015951 (1) 584bp
    GenBank:EB918650 (1) 497bp
    CITATIONS (2)