ZFIN ID: ZDB-TSCRIPT-141209-2877
Transcript Name: si:ch1073-205c8.3-001
Previous Name: ch1073-205c8.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053980 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053980|OTTDARG00000037723|ZDB-GENE-030131-1059 si:ch1073-205c8.3|no_translation CH1073-205C8.3-001 LG_ CU929079.6 Danio rerio processed_transcript NOVEL, 341 bp
CTGCTCGTGTGGAGGCGCATACTCTCTGGCCGAGCATCGG
ACTGTTTCTGCGGCGGAACACAATGAGCTTCCGTGTTTCT
GCTGCTCAGCCCTCTCACCGAGCCGTTACCGACACCGAGA
GGCTGATCCCGGTCCCTCAGCCCTCCAGCCGCTCAATCCC
CGCCGTGTGGATCCGCAGGCCGGTGTTCGGGAGCGCAGCG
GCGGATAAACGTGTCTTTTGTTCGCGCTCCGCTATTGTGC
TGCTGCGCGTCTGATGGCGGATCCGCGTTCATTCAGCAGC
AGACGCGGGAAACGGGCCACAACCTCTGACAGGACGCTGA
CGCCATCACATGCGATTCTGC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch1073-205c8.3-001 Contained in:
[Fosmid] CH1073-205C8 (1) (order this)
OTHER si:ch1073-205c8.3-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053980 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC146619 (1) 4016bp
    GenBank:BC065974 (1) 1198bp
    CITATIONS (1)