ZFIN ID: ZDB-TSCRIPT-141209-2440
Transcript Name: ottdart00000001811
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001811 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001811|OTTDARG00000001697|ZDB-GENE-980526-70 hoxb5a|OTTDARP00000001598 hoxb5a-001 LG_ AL645782.2 Danio rerio protein_coding KNOWN, 1953 bp
TTGACTCAAGTCTAACGACTCCCCGTCTCGTCATCATTTG
TAACCATAGAGCATGAATTACCTCTTGAAGTCATCAGTGA
GAATTTACGACTGGTCAACAAAAGCACGTGATTCTCAAAC
GCACCCCCACCCCCATATTTGGCCGCATACATAGCAAAAA
CGAAGTACAGTGCATTGCTATAATTCATTAATACATCATA
AATCGTGAAGCACAGCGTTATAACGACCAAGATCTACAAA
TCAAGCCCTCTAAAACAACCTAAATGAGCTCTTACTTTGT
AAACTCGTTCTCAGGGCGCTACCCAAATGGCCCTGACTAT
CAGTTACTAAATTATGGAACTAGCAGCAGCGCTATGAACG
CTTCGTACAGGGACTCCGGCACCATGCATTCAGGCTCTTA
CGGCTACAACTACAATGGAATGGACCTAAGCGTCAATCGT
TCAACCAGCACTGGCCACTTTGGGGCGGTTGGGGACAACT
CCCGGGTCTTCCAGTCTCCAGCTCCGGAGACGCGATTCCG
GCAGCCATCAAGCTGCTCGCTCGCGTCTCCGGAGCCGCTG
CCTTGTTCCAACAGCGAAAGCCTTGGACCCAAAGGCTCTT
CGCCCCCTTCCGACCAAAGCACCACCACTGCGGGTAATAA
TCTCAACAGCAACACACATTTTACAGAAATCGACGAGGCC
AGTGCTTCATCGGAGACCGAGGAGGCGTCTCACAGAGCGA
ACAACTCTGCACCCCGGACACAACAGAAGCAAGAGACCAC
GGCAACCTCCACTACCTCGGCGACGTCCGATGGCCAAGCT
CCCCAAATATTCCCTTGGATGAGGAAACTACATATTAGCC
ATGATATGACTGGACCAGACGGCAAAAGGGCCCGAACTGC
ATATACCCGCTATCAGACGCTAGAGCTGGAAAAAGAGTTC
CATTTCAATAGATACCTCACCCGAAGAAGGAGGATAGAGA
TAGCCCACGCTCTATGCCTCTCAGAGCGTCAAATTAAGAT
ATGGTTCCAAAACCGGCGGATGAAATGGAAAAAGGACAAT
AAACTGAAGAGCATGAGTCTGGCTACCGCAGGTAGCGCTT
TCCAACCATAGTTGTATCCCAAGACCTGCTACGTGGTGTG
CAAAAAATTACGCGGAAAATGAGATGAAAAAGAGATCTCA
AAACATTACCTACAGAGTACTGTACATCGCGGCACCTTTC
GGCATGTTATGGATGTTTTAGGCATTTTAAAATTCTACTG
TGGTACTGCTATAATGAAACGAAAATTAGTGTTCATATGT
TGTTCTTTTATGGTGACTTTAATTTTGGCAAGTAAATAAA
ACTGAAGGGAAAGAAGCTATCAATATAACGCTTGTTGTTC
TTGTTACAAATATTGTTTATGTGTCAAGTGCTATGTTAAT
GCTTTCTTGAGAGTTAGCATGTGAGCTCTTAAATGTTATA
ACTTATTTACCTATACACGTGTATAACTACCTTTTGAGTT
TACAGCTTAGAAACGCATCTGCCCTTGTATGAAGTGAAGC
TCTAGTTTAGAGGTGACTGCAGTAAATTTAGCAGAAGCCT
ATGTTTCATGGTCCTCTGTTTAATCAATGTCTAAATAATC
ACAATCGATTTGTCATGTGTTCACAATCTTCTATTATTAT
TATTATTTTTTTTGAAAAAAAATAATAATTAAATGGTGTA
AATAGACCTCGCTAGATTCTTGTACTCGTTCATACGTGTG
TATAGTTGTATTCCAAATATATAATTGTATATTACTGGAT
CATGTTTATGTTCCAAAAAAGGTTGTATATATTGAACATT
TTTATTGTGATCAGTTGGCTATTTGTAGTGGGCAGAATAA
ACGGCAATGTGGAAAAAAGTCATGTCAATCTGCCTGTTAG
CATTTTGCCAAAATGCTTTTTGTATTTGTTTGTAGTTTAA
CTTGGAGTAAAAAATAAAGTTCCTCATATTCAA

hoxb5a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxb5a-201 (1) 1790
ottdart00000001811 1953
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001811 Contained in:
OTHER ottdart00000001811 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001811 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:X12802 (1) 2073bp
    GenBank:AI794093 (1) 559bp
    GenBank:AI667153 (1) 549bp
    CITATIONS (1)