ZFIN ID: ZDB-TSCRIPT-141209-2091
Transcript Name: cdk2-201
Previous Name: cdk2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061121 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061121|OTTDARG00000042360|ZDB-GENE-040426-2741 cdk2|OTTDARP00000047305 cdk2-001 LG_ CU633767.5 Danio rerio protein_coding KNOWN, 1734 bp
GGGAGGGGCTTGTTCATTCGCTCAATTCATTGGTTTAGAA
TGTTGAATTGTATTCATGAGGCGGGGCTCGTTTTTACGCT
TTGTTGCGAGGGCGTGCTGTATGAAACGCGGGAACTGGCG
GCGGTATTGATATTAAGTTCTGACAAGAGTTTCAGTCGCC
CGTTTTAACGTATCAAATAAACAATTTTAATGTTTTTGAT
CGCCGGTTTGCATCGAATAGCACTTTCTCTGCACAGCTGC
TCTTTTAAATAGATCCAGAGTGACGGTTTTCCCCGGAAAA
GGGGCACTTTTGACATGGAGTCTTTTCAGAAAGTGGAGAA
GATCGGAGAGGGAACATACGGAGTGGTTTATAAAGCCAAA
AATAAAGTTACAGGAGAAACTGTCGCGCTGAAGAAAATCC
GATTAGATACGGAAACTGAAGGTGTTCCCAGCACTGCCAT
TCGTGAGATCTCTCTGCTAAAAGAGCTCAATCACCCTAAC
ATAGTCAAGTTGCGTGATGTGATACACACTGAAAATAAAC
TTTACTTGGTGTTTGAGTTTCTTCACCAAGACCTGAAGAG
GTTTATGGACTCGACGTCTGTCAGTGGCATATCCTTGCCA
CTCGTGAAGAGTTACCTATTCCAGCTGCTCCAGGGATTGG
CCTTCTGTCACTCCCATCGGGTTCTTCACAGAGATCTTAA
ACCCCAGAATCTCCTCATCAACGCTCAGGGCGAGATCAAA
CTGGCTGACTTTGGTTTGGCCAGAGCGTTCGGTGTACCTG
TGCGGACTTATACACATGAGGTTGTAACTTTGTGGTACAG
AGCTCCAGAGATTCTCCTGGGATGTAAATATTATTCTACA
GCTGTTGACATCTGGAGTTTGGGCTGCATCTTTGCTGAAA
TGATTACTCGGAGGGCACTGTTTCCTGGAGACTCTGAAAT
AGATCAGCTCTTCCGGATATTTCGAACTCTGGGCACTCCT
GATGAGTCTATATGGCCTGGAGTTACATCAATGCCAGACT
ACAAACCCTCCTTTCCCAAATGGGCTCGACAGGACCTGTC
TAAAGTGGTGCCCCCCCTTGATGAAGATGGCAGAGACCTT
CTCGGGCAAATGTTGACCTATGATCCAAACAAGAGGATCT
CGGCAAAGAACGCTCTTGTTCATCGGTTTTTCCGCGACGT
CACCATGCCAGTGCCTCCTTTACGCCTATAAAACGAGATC
AACTTTGGCAAGACGGGACTAAAAGTTTCACACAAAACTT
TTCTGAAAATGATTTCCCAGTTTGGAAATCGTTCGGTTTT
ATAATCGATTTGTACGCTCGTTTTCCTAAAGTCACTCTGG
GTTTGTTTTAATCTGAAGATTATCCATTGCAACCTGTCAC
TGGAAAAAAAACAGCTGTGCTAATAGTATGCGTGTGATTA
AAATGACTCGGAGGATGTAAATTTGCATAAAGCAGACGTG
ATGTTACTAACATAACTTTAGTTCGGAGATGACATTCCAT
GGTTATATTGCTGATATAACTTGTGACGTTGTATTGCTTA
TATCACACAAGTACATATCGCATTGAGCGCTTCGTCTAGC
CTTAGACTGAATGAAACTGTTTAGACTCCCTGTATCTTTT
TGCTGCTTTATTCCAAGATTATATTATTATAATTAAAGAT
TTTAAACCTAATTTGCTTTTAAAGTTTCCTAAAAATAGTT
CTCTCTGCATCTTCATCCATTAAACTCGTATAACATTTGG
TTTATGTTGTTACA

cdk2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cdk2-002 (1) 751
mRNA cdk2-201 1734
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk2-201 Contained in:
[Fosmid] CH1073-182B19 (1) (order this)
OTHER cdk2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061121 (1)
  • Ensembl_Trans:ENSDART00000036581 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)