header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1616
Transcript Name: mylk5-203
Previous Names: mylk5-003, dkey-194j22.6-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053504 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053504|OTTDARG00000037473|ZDB-GENE-050309-74 mylk5|OTTDARP00000042081 DKEY-194J22.6-003 LG_ CU062431.6 Danio rerio protein_coding NOVEL, 268 bp
GACCTCTGGCCTCCAGCCTCAGGGTCAATACTGCTTCCGC
ATCAGAGCCTGTAACACTGTGGGGGTCAGCGAACCCAGCC
AAGAGTCCCAGACAGTCACGATGGACAACCCAGATTCCCG
TGAAGAGAAGCCAGTGGAGTATGTGAATGTGACCATCGAC
ACTCAACATAAACTCACTGACCACTATAACGTGCTGGAGA
AACTAGGAGTAGGGAAGTTTGGCCAAGTGTTTCGGATGAC
CCATAAGGTGACGGGTCGCGAATGTGCT

mylk5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mylk5-002 (1) 410
mRNA mylk5-201 (1) 3153
mylk5-203 268
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mylk5-203 Contained in:

OTHER mylk5-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053504 (1)
  • Ensembl_Trans:ENSDART00000172456 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI959070 (1) 267 bp
    CITATIONS (2)