header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1615
Transcript Name: moto-201
Previous Names: moto-001, dkey-194j22.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053501 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053501|OTTDARG00000037472|ZDB-GENE-070117-1657 moto|OTTDARP00000042079 DKEY-194J22.5-001 LG_ CU062431.6 Danio rerio protein_coding PUTATIVE, 3868 bp
CACCGCAGACGCTTCGCGGGTATACTGGTGAGGAGACACA
GGCTACGGCGGATGATTTGCTTTATTTTATGTCACTCTGC
CCGTCGAAGAGTCGACGTCTTTAATTTATTCTTTAAAAAA
TCAGCCGATTATTTAGGAAAATCGTGAATATAAATATTTA
TAAATCCTAATTTATATCACAAGTAACTTATCGAGCGAGG
CCCAAAGTTTACAGTCAATGGAGGGTAACGTTAATAATGC
AGGGAAAAGCAAAATCAGTGTGGATGCAAATGGAGCAAGA
ACAATCTTGGATCGATTTCAGAATTCAGGAACAGACTCCT
ATTTTACCACCTACAAGCCTCAGACTAGTTTCAGTGACAG
CAGATTTCTGTCTCAGTCGTCCAACTCATTCTCGAACTGC
CAGATGCAAGACTGTGCTCCACTACCTTACACAGTTTGGT
CAACTCAGGAAGACTGGCCTCAAGCTATAACCAATAGCAG
AAATTCGATAAATGGCAATAATTGTGGCAGTGAGGCTGAT
CTTTATGGATTAGTGTCAGATATCTTGGATGAACCAGATT
CAGTGGACCCCTACCCCTCATATGAGAACAGGCTACCATC
TAGTTTGAAAGGTGTATGGTCTCCAAAGTTAAGAGAAAAC
AACATGCAGTATTTCAACAATGAGATGCAGATGCCACCCA
TTTCTGGATTTCCATCAAACAATATTAATCCTAAACCAGT
CACCAATGTCTGCCCTCAGCCTTTGGGTAGAGAATTTCAA
CAGTGGGCAGAAATTCAGAACTTTAATGGCTTTGATTCTC
CTCGTAATTTCTCTTCCTGTAATGGAGGGGCTGACATATA
TTCTCAAGACCTCCCTTGTCCACCAGGCCTGAACACACCA
CCATACACAACCAGAAAACCTGAGTATATTACACCTGACA
AAGAAGAAGGATACTTTAACCCCACTAACTCCACATCTGA
TTATATAAACACGGCCAACTCCTATTATTCTTCTCAAAAT
TCAGATGACTCCTATTTCAATTCATCTCATGACTTTTCAC
CAATGAATAAAGATAAACTGAGAAACATCCAATCTTTCTC
TGTCCAGGATGTCAGTAAGCTGGCCTTTCTGTTGGCAGAG
CAGGACATGAACTACTGCAAAGAACCAACCCAGAATGGGT
TTTTAACGCAGAGGAACTATGAAGAAATCATGGCAGAGCA
GAAAAGTCATCCTTTTCAAAGGATGTCAGAGCTTATTTCT
CAAAAACCAAATTTTAAGAATGAGGTGACCCGCAACCTTT
TAGAGCAAAGAGGAGGAAAAGCAGAGGATAAAAAGACTCT
TTTACAAAGACATTATAACACAAATGAATTTTCAGGGTTC
AGGTCATCTAAAGCGTTTTCACCTACTGTCATACCACCAG
CCCTGTACCCAAATAAAGAAACCAGCCTAATGGAAAGTGG
CATAACTCAAACCAGTGTTAATCTCTTTCACCCACTCCAG
CCAAACCATTGTCAAATCCAAGCAAATATTCCAGCAAAAA
CCAGCAGCAGAAATGAATCACAGGGCTTTGCGAATCTCAC
CACAGCTGGGTCAGCTCAATTACTTCCTTCTCAGCAGTTG
TTCCGACCTGCAGGGAGAGTCCCGACTGATCTGAGTCAAG
GGAACGCAGTAAATCTACATGGTGCAATAGGCCAGGTCAG
TCTTGAGGCTTTAGGGAAGGGAACAGGAAAAGTGGACATT
TCAGATTTTGATCTCAAGCTAGAGAACAACAGGTTTACTG
CAGGCCTTATGTTAGATGGTCGCTTTAATCCGCGATCTAG
CATGAAACCCAAACTTCCGGAGGCAGAGAATAAAGCTGGA
CTGCTGCAGAATCCATACCATGGGCTGGCCAGTTTGTATG
AAAGACAAGTAAGACACAACGAAGCTAGTTCGAGTTCAAC
CACACCATCACACCCTTTCCCATTCCTATATCAAATGGGT
GATCCCAGAAAAAGTCAGTACCATTCACAGCCTTCACTGC
CCTTCTGCTCTGTGCCTATTATCAATGTGAGTGAACGTCT
ACCAGATGCAGATATTTCACCCTTCAGCCCCTATCTACAA
GAATGTGCCGGGCTAAGCCAAGCATCAGGAGATGGGTTGT
TCTCAGGGTTTCTCTCTGCTATGGCTTTGCCTAAGCTTGG
CAAAGCACTTGGAAGTCCCAACAGTCAGCTACACTTTTAC
CTGGAGGAATGTTACGAGCAGTGGAGGATGCTGGAAAAAG
AGAGAAAGAGAGCGGAAGCTATTCTTACAAAGGCTTACCT
GGGTAAACTTGTGTCTATGGTGGTGACCAGTAGCAGCTTA
CCCAAAATGCCTCCAAACCCCTCCAGAGTGGACCGGCTCA
TTGTGGATCAGTTGCGTGAACAGGCAAGAGTGACAGGTTT
GCTGGGGAAGATGGAACAGTTGCGGAGTTTTCCACTTCAT
GCTAATATCAGCTCAACATTGGACAGGCATCTTGAGGTCA
TCTACATCACTCAGGCACGCCGCAAGGAGGAATTCATCAA
TGCTAGCAACAGACAGAGGCAGCCGGCGGCCTTCTTTAGA
GAGGACAGGGAGATTCTTATGTTGGCATCTGCAGTGAAAG
ACCTGTGCATCAGCACCAGAAAGGCCAGAACTGCTCTTTG
GTGTGCATTACAAATGACTTTGCCCAAAACAAGCAGTTAC
CAAGAGGAGGAACTTGACAAAGGTACTTGCTCCCCTTTAG
GCCCAGACAGTCCTGAGCAGTGCAGGTTGGAGAGATCACA
GACTACCCTGTGATGCCTTTCTGACAGGTATATGGTGTTT
GTACGTTTTTTTTCCAAAAAAGTACATTCATCTAAAAGGT
GATGAGGTTGCATTTTAAGAGGAATGAATAAGTTATTTAA
GTTATTCCACTATAGTGACACATTAGGCTCAGTTGTGGGC
AGCAGATGGAATTCTTAGTTCATTAATATTTATCAGTCTA
CTGTGGAAAGGACCAATCAGATTCTCCAAAAACATGGAAT
TATGGCAGTAAGATCAGTATTGAGGTATTTGTCCAAGGAT
CCCAGAAAAAAACTGCCAGTTAGAACAAAATGATTTGAGA
GAGATAGCATAAGATTGATTTAAGAAGAAAGAGTAAGAGA
GATGAATTCACAAGAGGGAACTTTTAACTGTTGATAATGA
AACCAAATGTGTGGCAAGAGTAAAATCTGTGGCTTTGGAA
GATAATATTTTTGCCTCAGAAATGTCAATTGAGAAATATA
TAAATAGTTACATAGGAAACAATTATTTGCGTTAAAGGTC
TTTTGACAGTTTAATTAGTGTCTCCTACAATCTACGATCC
TCAGCACATTTTAGGCATTCACAAAAACAGTATTTATGAC
CAGTAGGACATGTTCGCGTTGTCCTGGCCTTATTTATTTG
AGCAAGATTTTCTTGGCGTCAGCACTTGTTTTTAGTGATC
TTACTGGATAAGCAATAACAACCCCAAATCATTACATAAA
TCTGTCGTTTGTTTTAGGGAAAAACTGAATGTGAGTTTAT
TTATTCACCGTTTGTTTATCTAAATTCTGAATTTAGCTCA
AGTTTCCAGTCGCCATTTTTCAGTGTATGTATGTGGTCAA
TCTGTCTGTGGTGTAACTCTTTTGAGGATCTGCGGAGTAG
CTGAGAGTACCATCATTCATGGACTGACATAAATGATGTA
AATGACATGTTTAAAGGCTAACATTGTTCATATGATGTGT
ACTCATACTGTATCGTTTCATTGCTTTTGTTCAAGTTTTC
CAATTAAACTAACAGCAGTAAATCCCTTAACTCAAAGACT
GGTGCTTAACATACAGTGTTAATCAATGCTAAATCAGCAT
TTCTGCAGTATATTTTACTCATTATTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
moto-201 Contained in:

OTHER moto-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053501 (1)
  • Ensembl_Trans:ENSDART00000124559 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN331380 (1) 842 bp
    GenBank:EB924810 (1) 395 bp
    GenBank:EB912099 (1) 370 bp
    CITATIONS (2)