header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-973
Transcript Name: galnt8a.2-201
Previous Names: ch211-276c7.4-001, galnt8a.2-001, si:ch211-276c7.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056484 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056484|OTTDARG00000039338|ZDB-GENE-131122-40 galnt8a.2|OTTDARP00000044292 CH211-276C7.4-001 LG_ BX004976.7 Danio rerio protein_coding NOVEL, 2171 bp
GCGTCTTGCACTATATAAATCAAAGCAGACAGTCAGCTCT
ATAAATAATCATTCGTATCAATGGTATTATTTTCCATGAA
CGCATAAAGACATTTTGAAAATGAGGATTGGAGCGAGGGT
CAGCGTGTTATTTATTATTGGTATCATAGTGTACAGTGTG
GTGAACGTGTCGTTTATCAGACCAGAGAGGAATAATGACA
GCACATTACAGAAGCCAGAGGAGATAGAGCTTTTTCAAAG
GCTAAAGAGGATAGAAGATGAAGTTCATGAAATAGCCATT
AACATCAAAAACCAAAATGTCAAAGAGGCTGTTGTGAAAC
AGAAAATCACTAAGAAAACTGAGGTGAAGAAGTTATATCC
GAAGTCAGCTCTTTTCAAAACCTGGGGAGCTGAACTGACA
GAAGAGGAACAGATGGAAGCAGAGAAACTGTTTCAGGAGT
TTGGATACAATGTTTTCCTCAGTAACAGATTACCATTGAA
CAGAACAATCCCTGATACTCGAGATCCCAGATGTTCTCTG
AAGATCTATCCGAAGGACTTGCCAACCATTAGTGTGATTC
TGATTTATCTGAATGAGGCTCTGTCAGTCATTAAAAGAGC
CGTTCAGAGCATCATTGACAAAACTCCTGCTCATCTGCTT
AAGGAGATTGTCCTGGTAGATGACAACAGCTCTAATGAGG
ATCTGAAATTGCCTTTAGACAAATATATTGATCTAATTAA
CAAAGGCAAACCTGGTTTGATCAAGAAAGTGCGACACAAA
AAGCAGATGGGTCTCGCCAAGGCAAGAATGTCAGGCTGGG
AAGCCGCCACAGGTCAAGTGGTCGCCATTCTGGATGCCCA
CATTGAAGTTCATAAAGAATGGGCAGAGCCACTACTTGCA
CAAATTAAAGCAAACAGGACAACTGTATTGTCACCAGTGT
TCGACAAAGTGCTTTTTGACACACTGGAGGTTATTAAGTA
TAATCCTGCTGCTCATGCATTTGATTGGAGCCTTTGGTGC
ATGTACGAGCGCTTCCGGCCAGAATGGTACAAACTCAAAG
ACCCATCAGAACCAGGGAAGAGTCCTTCAGTCATGGGTAT
CCTTGTCGCTGACCGTGAGTTCCTGGGAGAAATTGGAGTT
CTGGATGAAGGAATGACAATTTATGGTGGTGAAAATGTTG
AACTAGGCATACGTGTCTGGCTCTGTGGTGGGAGTGTCGA
AGTGGTGCCATGTTCAAAGATTGCGCATGTTGAAAGAGCA
CATAAGCCTTATTCACCAGATCTCAGCAAACTCATGATAC
GAAATGCATTGAGAGTGGCTGAAATCTGGATGGATGAATA
TAAATCCAATGTGAATATCGCCTGGAATCTGCCTCTGAAG
GATCATGGGATTGATATTGGTAATGTGACTGAAAGAAAAC
AGTTACGTGAGAAACTCAAATGTAAGCCCTTCAAATGGTA
TCTGGAAAATGTATATCCTCTGCTCGACAGATGGGACGAC
ATACTGGGTTATGGTGTGTTGAAGAATGACATTCTTAAAA
CTCACTGCATTGATCAAGGACCTGTTCCTGGAAGTGTACC
TGTTCTCTTTGGGTGTCATTACTACGGCCCTCAGCGTTGT
TACTACAAACGTACTGGAGAGATTTATGTTGGCAGCATTA
AATCTCACACTTATAACTCTAATCGTTGTCTGACGGATCC
TGGTAGTGGAAGCACTGTGACTTTATATAACTGTAAATAT
GCCAAGGAGAAAGGATTTAGTATTTACTGGGACTTCACTC
AGGGAAAAGAAATAAGAAACAAAAAGACAAACCGATGTAT
TGAATTAGCACAAGGACAGGATACATACTATTATCTAGTT
TTGCAAGCATGCACTGGACAAGAATGGACAATTCAACATG
CCTTTGAAGAACTAAAGGGGAATTTCACTGAAGTGAAAGC
AACGAAGTGAATGTAGAACTTGAAAACAAAATGTATGTGA
GTATGAAAAAATGAATATGTCAGTGCATATGTGGGATACA
TTTGATAAGAATTTTAAGCATCACATTTATCATATTCTTA
TAATTAACTTATCTTATATTGGTGAATGTGTGCAGCAGAA
ATTACACCCCTGACCTGTTTTTTGGTGGAAATACTTTTGC
ACAGTACTGTGTGTAGGCATGGGATGGTAACTCGTTTCAA
GGTTTACCAGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
galnt8a.2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056484 (1),  Ensembl_Trans:ENSDART00000157075 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)