header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-908
Transcript Name: itga11b-202
Previous Name: itga11b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056252 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056252|OTTDARG00000039186|ZDB-GENE-071009-4 itga11b|OTTDARP00000044116 itga11b-002 LG_ CU183952.17 Danio rerio protein_coding KNOWN, 360 bp
ACCCAATGTTTCTCCATGAGGAACGGCCCATGAGACACCT
GCTCTGCAGCTCTCCCACAAGTCTGATGCACAACCAATCA
GCTCGCTTGATGCGTGGCCAATTAAAAGCGAGGAAATAAA
GCAGAATTTGAATATAAGCAAAAAGATTGATAATGTTAAC
TAGTAAACGAAAAATACAGATGAATAGGCTTCAGTTTTGA
ACCATAGTGAGGTTTTGGTGCTGATTAATAGTTACCAATA
TTAAAAATAATAAATAATAAATGTGTATCATGAAACAAAC
CTCAGATTGTAGACCCTCAGCATGAACTCGAGCTGATGCA
CTTGCACATTGTAAAGAATTTTGAACTTGAAATTTGTAAA

itga11b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA itga11b-201 (1) 4362
itga11b-202 360
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itga11b-202 Contained in:

OTHER itga11b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056252 (1)
  • Ensembl_Trans:ENSDART00000154865 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM776606 (1) 360 bp
    CITATIONS (2)