header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-76
Transcript Name: mtmr11-201
Previous Names: mtmr11-001, ch211-271d10.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047641 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047641|OTTDARG00000033801|ZDB-GENE-130530-726 mtmr11|OTTDARP00000037414 CH211-271D10.1-001 LG_none CR933818.11,CR848792.12,BX537142.10 Danio rerio protein_coding NOVEL, 8585 bp
GGTTTTTGTTACTCAGTAACACCCGTGTCATTACACACTA
TGGCGAAGGAGCTGTAAACAAATGCTCAGGAAAAAAGCGG
GTTTTCTGTGCAGCAAAAATAGATGTGATATCGCGAATAA
TTCACTATATTGACATGGTTAGGATGGAGAAATGTGTGAA
AGCGCTTTAATGATGCAGACTGGACGTGGACCATCCGATT
TCTGTAACGTATACATGGAGAGGATCATACATTTACCGCT
AAACCTCCTTCGGATACACTATTTATGCTGATAGCGTTCG
TCCAGAGCCCTTTTATGTTGAAATCATGTTGACAGGATCC
AAAACCACCTTTAAAGTGAGGCAGATGGTGCCCGACATGA
AGGAGAGGATGATGAGCCACAGTAGCCTTCATGCACGAGG
AAGAGATGTGCTCGGCCTCTGCTGTTTACCAGGAGAGTGT
GTGCTGCAGCGAGCCGTTCTAGTAAGGAAGAAGCTGTCTG
CTAAAGAAGGAGGAGGCTGGTTGTCTGGGACTCTGTTTTG
CACTCATTTCAGAGTTGCCTTCGTGCCTCAGGACAGCCAG
AAACCTGACGATAATGCAGATCCTGTGTTGCTTGGAGATC
ACGATGTAGCTCTTGCCTCCATTGAGAAAGTCGTGGCAGT
GGGACCATCTCGCACCAAACTAGTGACCCCGACCTGCTCT
CTGAAGTTCACTCCAGAGGAACTGGTGTTGTACTGTCGAG
ATCTGCGGGTCCTCTGCTTTCTCTTCGACAGACTCACGCC
TGATACTCAAGCTGTAGAGATCACGTACACCATTGCTAAA
ACCTACCAGCCATTGAAACCTGGCACCATCCTCTCCTTTC
AGAATGCTGCTTTGGGGAGTATCGAAATGAAGCAGTTTCT
AAGCAACAGGCGGCGTGACCCCAGCATGAACTGGTTGGAG
TGTTCGCTGGGATGGGAGCAGGAGCTGGAGAGGACGGGTG
CCAGCGGATGGAGGGTCAGCTCTGTCAATGACCGCTTTGA
GATGTCCACCAGTCTGCCAAGATTCAATGTGGTTCCTCAG
AGAGTTCTAGACACGGAGCTCAAGAAAACATTCGCCCACT
TCAATGAAGGACGAATCCCACGATGGTGCTGGCGGCATCC
TCGTGGCAGTGACTTGCTACGAATGGCCAGCTTCCAAAAC
AACATCTACCATGAGAAGGACGACATCAGGAATCTGGAGC
TGGTGCTGTTTGGCGGACAGCAGCTGTGTGTGATTGTGGA
TCTCGGAGAAGAAATGCCTTCGCCTGCAGACATCCAGCTG
GCTCACACCAGACTCCGGACACTCTGTCTGGGTGATATTT
CATCATCTGTGTCAGTACCTGATGATAAATGGCTGTCCAC
ACTTGAAAGCACTCGCTGGCTGGACTATACCAGGTGCTGT
CTAAGGAAAGCGGCAGAGGTGTGTTGTTTGCTGCGAGCAG
GACACATGACTGTTGTTCTACAAGAGCCGGAGGACCGGGA
CATGAACTGTGTGGTCTGCAGTTTGGTTCAGGTGATGTGT
GATCCTCACTGCCGGACCGTGGCTGGATTTCAGGGCCTGG
TTCAGAAAGAGTGGATCACTGCCGGACACAAGTTCCTCAG
CCGGATCAACTACCACCGCGAGAGTGATAAAGAGGAGGCC
CCTGTGTTCCTGCTGTTCCTGGACTGCGTGTGGCAGCTGT
GGGCTCAGTATCCCGCTCGATTCCAGCTCACTGAGGACTA
TCTGCTGGCTCTGCATGACAGCGTCCATCTTCCGCTCTTC
AGCAGCTTCCTGGCCAACAGTCAGAGAGAGAGATGTCGGC
GTTCTCAGCATCTTCCGCAGAGCTACACCCCAGTGAACGG
CCTGAGAGATGTGCCCATGAGCGTCCCAGAAGAGCCCGTG
GATCCTCCGTTCCCCCCGGTGTGGGACTGGGCTCTGCAGT
ACAGCAGTCAGAGACGAGCCCGCTTCACACAGCCCATATC
ACAGCCCACCTGCCCTCCACCCGTCCTCAACGGAAACCTC
AACACCAACCTGGAGCGCAGCTGGCACAATGACGGTCTGC
CGGGTTCTGTGTTCCTGTTGTCTCGAAGCACATTTTCCCA
TCCCTCCAACCTGCTTCCCTGGAGGAGTAGCAACTCTGGC
TCGTACTGGAAAAGCCACCGCAGGGCTCCATCCTCTGAGA
GTCTGTCTGGACTGGAGCGTCTCATCAGAGCCTGTTCGCT
CTCTGAACCTTCAGAGAACAACACGATCCTTCATGATCCC
TACGAGCCCCTGCTCCCCCTGCTCTTAGGGCCCTGTGTCA
GAGTCTGGAGGAGCTGCTATTTAAGAGGAGCACTGCATGC
TCAGGCGTTCTCTCACCCCGTGTCATCCTGCACGCAGCAT
CCAGTAGATCAGCTGGCCTGGGAAGTGCAGCAGCTACGAG
AGAAATTGGCTCAGGCTTCAAACAGACGCCCTGAAAACCA
GATCAAACACCAGGAGGCCCGAAGACCAGAGTCCAACCTC
AACCAGAACGCCAACAATGGTACCTTCCTCTTCTCTTCCT
CTCGAGTCTCTCAACAGCAGCAGCAGCAGGCGCCGTCCAG
CCGAGGAGCAGCCCAATCCTCTGCTCCTCCCAGACCCCAG
CGGACGGCATCCGACCCCCCCAGACCCGCTCAGAGGAACA
GCGGAAAGCACACCTTTCTGTTCGGACACCAGCAAGAGCC
TCAGTCGGGCCAGCGTTACATTCCTTCCCCTAGTGCCAAA
CTTCACAAACGCCCAGGAAACTCACAGTGATCTGTAGGTG
AACTATTCCTTGTAGGTTTGATGAAAAGGACTTGAACGCC
TCTGTGATGTGGGTTACAAACTGCTTCAGAACTGTGAGAC
TTTTTCAGAAAAAAAGGTGTTATGCCACAGACGTCTGACA
ACAGTGACTTTCTAAAACTGAGAGAGAGAGTAGCTCCAGA
GGCTTGTGTCCTACTTTTATTTCCCCTGCGGGGAAAAAGG
TGCTGGCAACATTAACACAGGTACCGTTTTATCTTCTCCT
TCGCATATCTATTGGAAGCCCATTGTGACTTGGCAATTCG
GTGAGAAAAAGTCATAATTGTGAGCTAATAAATTATTACT
TGTGGGATACTGTATAAAATTAGATTAGATTGAATTGCGG
GATGTGAGTTCTGAGATCTTTTACATTCAAAATTGTGTTT
GTAACTTGAATTTGCAAGATACTTTAGATTTTTGAGGGAA
AGAACTCAGGATTTCACTTTTTACATATACAAATTTTAAG
TTAAAGGCGAAATTGGAGATCTTGAAAATGCTAATGTTAG
CCTGATAGCACTAAAAGCTTTCATCCCACTTTTCAAAGCT
ATACCTCCATAAACATGCATTAGACAACATCATCACTTCA
ATCCCAGAGAGCAAAATACACTCGGGCCAGGTCTGGCAAT
ATTACCGCCAGCCAGAGACTTGCCACACGGGCCGCCTCAT
CACATCACATACATAACATGTTACATCCAGGACTTAATTT
GTGCTGGAACAAGCCGGATCTGGAACCTCTGAAATCTGAT
CCGGCACCTCATTTTACTGATCCCCCTCTTCACACGGACA
CCCAATGTTCACTTTCTTCCGCCACTCCCCAAAATTCGTC
CATGACCTCACAATTTACAGATATCACCAGAGACATGACT
TTATAGTACAGGTAGTAATTTAAATACCAATTTAATAAAG
AAAGTATGTTGTTGATGTTTACGGGCCATTCTCTGTCTGA
ACAAACGCCATCTCACAGCAATTTGTAAGTTTTTTTATTT
AGTAGCTAATTTGTATGAATTTGTATAATCTCATTCTTAC
AATTTAGTATGATTTGCTTACCCCCAATAATGGGTGGCCT
TTAGTGGCATGCCTCCTTTTAAAAATATATATTTTCATAT
GACTGAATTGGCCACTAACCTGACAAACGTAAAATAAATT
TTGTTTCCTCGTGAGATCAAGCTGGTCTGAACCTCGTCTG
TGACGCAGGCCTTTCTGAGCAAACAATGTGTGCAATGGGG
TATATGCACAGCTAGGGTTTTTCTTCCGGTGGAAGCTTAA
TGTGATCATTTTCAATTTCATATTGTTTCCTTTTACAACA
TCGATGTTTTAATGTATAATCAGTTAAATGACCTAAGCAT
TCATTTAGTTGTTCAAACATAAAACAAGATGAAAGACTCT
AGGAATCTAAGATGTGTCTTTCAGCAGGCGAGCGCAGAAA
CTCCATTGAAAATACTGGGGTAAAGTAAACTGGCATATTT
TGAAGAGATGGCAGGGGGGAGTTGAATTTAATGCTGTGCT
TCTTGTCCGTTTTGAGAACCACTTTATATTGTATATCTAT
CAGGGAGTAAAGATGACTGATTTTCAAAGAAATTAGACCT
TAAACGTGGCAATTTTATAAAGACAGTTCACCGGAAGCGC
TAAAGTTTTCTGGGTGAAACTGAAAGTCCGTGTGCATATA
ACCTATTACTCATTTTGACATTATGTTATGATTATGTTTT
TACTAAACGTTTTAAATAGACAAACATTTCATGCTCCAAC
ACTTTTCACAGAATAATAAAATACATATAAATGCATTTGT
ACCACATCATGACTGCAATCAGGATGTGAAGAAACCTTCA
ACCAGTCTAACAAAAATGTTCAATGAATCACCTATTTCAC
CTTTAACATCTCACTATTTTGACTTTTTCTCTGAAATGTG
AGTTTATATGTCTTGCAATGTTTAATTATAAACTATAGAT
ATGTAAAAACACGATTGTGATTTTAAAAAAAAGTTGAATT
TGTATGATCAAAGTCAACTTTTTAAAAAACTTTTAGTATT
ATTATGTGGTGGACAAAAGCTTCCATGCATATCAGTATGT
GGTGATTTAAGAGATTCAGCAGAAGTGGACTTGCATCAAC
ATATTTCACAAGACTGAATTTGCGCAAATGTTTATTGTCT
TGCATTTAATGAAATTGCCCAATGCTTCTGCCTTAACATG
TAACTTGTTTTGTACTTTCATCCTTGCACCTGGCACAAGG
GCGAATGATTACCTATTTTCTTTTCTTTTTTTCATTGCTT
ATTCTTTTATAGCGACCTTCATTGGCACATAGATAAATAA
AATGCATCTTAAAGTTCCTAATTACAATTTCATGTTTTGA
ATTTCTTAACAATGGTTATTAAAAATATATGACAAACGAG
CCCAGGAGATCCTGACATGTTCGATTTCTTATCAAAATAG
AGATATTTACAACATGAGCACTTTACAAGAAGCATTACAA
CATTTCAAATCAATCAATTGTGAAATGACTCCATAAATAA
TCGTTTACGTCAATGGCACTTATTACAAAAATACAGAAAA
GCTTCACTAATGTATATCATCTGGCATTAAAAAACATAAA
ATACAGCAAAATTCAAAATGAATCGACTAACAGCAGGTAG
TTTAAGTAAAACACTTCCTTTACCTTTCCTCAATTATGGC
ACTAGAGAGCGTATGATATCAGTCAGATTCACTTACGACG
CAGGTCTCATTTAATGTATTCTCATTTAACAGAAAAGGAT
TTTAAAATAATGATCGATATGAAGCCTAGACCCTTTAAAG
CAATAGCAGATCACAGAAAATGACAGATCTGAATTGATCA
TTTGGTTTAGAGTAGCACACTTTAAACTTTCAGTGCCTCC
ATTTTATGCTTGTTCAGATAGTATATTTCATATTGTAGCT
GTTGTAAAAGGTGTATGATAAAAGAGAGAACCAATTCTGA
ACTGCGATAATTCCAGTCTTCCTGCACAAGCATTACGTAC
TGTATGTAACAAAAGCCTGTCTATGGTCTTCATTGACTGC
CTGTGAACATATGCATTGACCCTCAGGCCCTGTTTACAAT
AATGCGTTTTAGTTTGAAAACGCATAAGTTTTGCAACGGT
TACACCATCCGTCCACACTACGCCGGAGTTTTCGAGCGCC
GAAAACGCTGAAGATTCCATTTTCATTCTAAAACGCTGCT
GCTCCGTCTCAGTGTGGATGGGGGAAAACGGAGACATGTG
AAAACGGAGGCGGGGCTGCTGACATTTGCTGCCTGATTGG
GGCTTTTGTGTCATTGCGTATCCTTCCCTTAATCGTCGAG
CCCCTATCACATGACTATAACACATGGCTTTGACGCTACC
GGAAGACAGCAGACCAGCCTTCACTGTAAACAACAACATG
GACACAGAAATGGGAGCGTTGTTTGCTCTATTGTCTGTTT
TAGGCACCATTGTGCAGTTTTTTGCACGGATCGTTTTTGA
TCTAAAACACCGTTTTAAAACTAAAACTCACTAGTGTAAA
CGGGGCCTCAGACACCTTATTTGTGGCTCAGACCGGAATA
GCTTGGTTTTTGTTGTCAACATGTTGAAAATAGGCTGTTT
ACTGCAAATCCATTTTCAAACGGATGAGAATTTGCTCCTG
AATTGATATAATAAGCTGAGAAACTATTGTTGTTTGTTTA
TATTACTGTTTACAAGTGCTGAAACGCCAAATGCTATCTT
TTTGATTTTGTGGCTAATTCGTATGAATCATTGACTATGT
TTACGTGGACATCAATAATCAAACTATTTGCCTTAATCTG
AATAAGACAATAATATGATTAAGGTGTTTACATGAGTTGC
TTTCTGAATGTTCCTTTCATGATCCCGTTTTACATGTTAT
AGCACATAAATCGATTATTGTCACTGCATCACCACGCTAT
CCACATTTCCTCTGCCGTTTCATGTAATTTTGGGTGTTTC
ATTTTTAATTTGTAAACTTTAACTGGAGTTTGGCACTTTC
ACTTTCATTCAGGAACATTTCATGCATGCCCCCCGTGTCA
AATGAGATATTGGAGGTGAGTATGAGTTGCTGGAAGAGTG
TGGTTTTAATGGAACTTGATACCACACGCTGTATGGGGGA
AGAAAACCTTGGCATTTGGTGATACAGGTGTATGTGGTCC
TTCACTGGTAGGTGCAGAAAATAGTGTCAAACAGCCGTGT
GTGTATAGACTCTCCTGTCGCAAAATGCGGCAAAAATCCT
ACTCATGGTTTGATTGTGGTATTTACATGTCTGTACTGCA
CTTTAATAATGTGATTAAAATCGTCATACTACAGTAGTCT
TAATATGATTTCTGTTTAGTTCGATTATGACCTTAATTGG
ATTAATTAACAATCTCTGTTTGCATGGTAATTTTTGATCA
GAGTATTGGCCTAATCGTATTAAAATTGGATTATTGGTGT
CCATGTAAACATACTCAATGATGGTTGGGTTTAGGGGTGG
GGTTTGGTGCCACGCCTCCTTGTAAAAATTGGACATTTTC
GTACGACTCAACTCGAATTAGCCACTAAATTGACAAAACG
TAAAATAGTTACATTTCTTTGTGTGATCCAAACTCAGATG
CGCTAATCAACATTTGGATTCAGACATGTGGTCGACCAAT
CACAAAACACTGGTCCATCTGACCAATCAGAACAGCAGCA
GGCTGTCAGGAAGGTGGAGTTTAGAGAGACCAGGTCCTTG
TTCGAGACCAGGGGTGCCTAAACTTTTGTCCTGGAGGGCC
GGTGTCCTGTAAATTTTAGCTCCATCTTGCCTCAACACAC
TTGCACGGTTGTTTCTAGAAAGCCTAGTAAGAGCTTGATT
AGCTAGCCTAGGTGTGTTTGATTGAGGTTGGAACTAAACT
TTGCTGGACACCAGCGCTCCAAGACCGAGTTTGGGCTCCC
CTGTTCGAGACAGTCCTTGCTGCAGCCTGCAGCTTTATGA
CGTACTAGACCAGGTCCACTACGTAGTGGACGATTGTCTA
CACATCCTTCAACCCAACTGTCACAGTAGTGTGGGAGTTA
CCTTAGTGGGCATTGCAATGTCCTCTACGCAGGGGTGCCG
CTAAGGGGGAAAAAGTTAGGACAATTCTAAGGGCCCACAC
TGTTTTGGGGCCCACTAGCCCTAACATCCCTGTCAGCCCT
AAAACACCATACACCCCCCCCCCCCCAACCCCTGCTTTTC
ACTTAAGTCTGCGACACAAATGAAATGTTATTATAGGGCC
TGTTCAGCTAGCGGCGCCCCTGCCACTACGTATTTGACCT
GGTCCAGTACGCTATCATGATATAAACTGTTCAGACACTT
GTGAGAAAAAAGCTGATGCTACAATTGATATGATGAAAAA
TGAAAGTGTTTTTTGGACTTGGATGAATGTAAACCTTTTA
CAGGAGACCTATTAAAATGAGAAACCTTTCTGTTTTAAAG
GAATAGTGCTCCCAAATAATGAAAGTTACCCTATAATTTA
ATCACCCTCAAGCATCAAGTGTATATGACTTGTTCCAGTC
AGACGAACACAATCAGAGTAGTTTTAAATTGTATTCTTCC
ATGCTGTATAATTGTGTTGGATAACGGCTTTTATTTTGAA
GCTTTCGAAAGCGCATAAATCTATCGTCAAACCAACTCAT
ACGCTGATAAGGGATAAACGCATGTCTTATGAAGCAGATT
GATGTGTTATTTAAATTTTTTTAATGATCAAATTACCCCA
TAGCTGAATGCATGTTATTCGTGACTTGCATACAGTATAT
GACGTATGATGTAAAGGCTGAATTATACTTCTGCATCAAG
TGCAAGTGGATGATCCAGGGCAGCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mtmr11-201 Contained in:
OTHER mtmr11-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047641 (1)
  • Ensembl_Trans:ENSDART00000101753 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)