ZFIN ID: ZDB-TSCRIPT-131113-618
Transcript Name: patz1-201
Previous Name: patz1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055056 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055056|OTTDARG00000038428|ZDB-GENE-111223-4 patz1|OTTDARP00000043178 patz1-001 LG_ CR293534.5 Danio rerio protein_coding NOVEL, 6848 bp
GGCCGCTTGCCTATTGGTTAAATCCACCCCTGCAATCATC
AAATTATTTTATTTAAAAAATAATTAAAAGACTCAAATGT
TTTAAAGCACTTCAGGGTGAATAAACTGAGTAAAATTTCA
TGTTTGGGTTAACTGTCCTTCCTTAAAAGTATTTGTGCAT
CTGATTGTCAAAGCAGCTAGACACACAGAGCCAATGTGCA
CCAATTACCTTGCTCTATTGTGTCTTTGTGCTTGATCTGT
TCCCTGGCAGTTCAAGACAGCAGCTGTCTGACCGACTATC
CAGGCTACAGCGTCCTACGAGAAGAGTCCTCACTGTTCAC
TTGGATTATATACACGTTTATCGTACGTTTTCCAAGTGCT
TACAGTGTCAGAAAGAGAAAAAGAGACGGTCTGCTGTCAT
GCATTGAGTGTCTGGCGTACATTTGGGGGAGGGGGCTCGC
TGAAAAACAAGGATGTGAATTCACAGCAGCGCCGCAAACC
AGGAAGACGAACAGCATGCGAGCTGAAAACTTCAATATCG
CTGCGTGAATAGCATCTCCGTGTCCTTTATAAACTTGGAA
ACCTGATTAAACTGCGTGAAAAAAAATTGAAGATATTAAA
CGCGGACGACACCCCCCTCCCTTTAAGCAAAGGTCAAAGG
TTACAGGAAGCTGGGGGGCTGCCATTTTTCCCCCTGCTAA
CATGTTAGATGCTAAAAAGGCAAGGAGTGGTGGTCGCTGC
TGAGCGCTTGTGTTTATTAGGTGTTTGTCATCGGTTTGCC
TCTTCTGTCGTATGCGTTAGGCTCGGTTGTTGAATGAAGG
CGGCATGGAGAGGACAGAGCAGCCGTGGAATTCCTCCTAC
ACGTACCAGGTGAGCAAACACAGCGCCGAGATGCTACACA
ACCTCAACGGCCAGAGAAAAGATGGAGGCAGGTTTTGTGA
TGTTATCTTGCGCGTCGGAGAGGAGAGCTTCCCCGCGCAC
AAGGCGGTGCTGGCGGCGTGCAGCGAGTATTTCGAGTCGG
TGTTCAGCTGTCAGACGGAAGACGACGGCCAGGGCAAGGA
GCTGGAGATGCACACGATCAGTCCTAAAGTTTTCCGAGAC
ATCCTGGACTTCGCGTACACCTCCAAGATCGTGGTGCGCC
TGGAGTGCTTCCCGGAGCTGATGACCGCGGCGAAGTTTCT
ACTCATGCGGTCCGTCATCGAGATCTGCCAGGAGGTCATC
AAACAGTCCAACGTGCAGATCCTCGTGCCCCCTTCCCGCG
GAGGCGAGCACAGCCTGTTCAGGGCCGCGGAGCAGCTGTC
ATACCCCCTACCCGTGGACATGTCAAACGGGAGCGTGTCC
AACGGCGCTGTGTTTACCGACAACAATGACAGCGACAGTG
CCGATCCAAGCAACATCTCTCAGCCAGCCGCTCCCGGGGC
TCCAACGGCCGATCGCTTAGCGGTTTCACCGTTGGAGTTT
TCCAGCGGCCACCTAAACATCGACGGCTTTAAACGAGGAA
AACCCAGACCCAAAAAGGAGCCCATAGCGCAGCCGGTCAC
TTACAACAATAGCACTGGTCAAAACGAAGAAGGGGCCCTT
TTCTCCTGTGGGATATGCGGGAAGATGTTTCCAGACGAAG
TCCAGTTGAGAAACCACGAGGCGCAGCACGGGACTTTCAC
CGGTGTCATGAGCAGTGGAATAGAGCTGGTCGTTGTTGAC
GGCCCGACGATGATCTCTCATCCTGGCCAACAGAGATTTC
AGGGAAACGGACTACCTACGGACACCCGTAAACGCGAGAG
GACGAGACGACACGTCGCGTGCGACTTGTGCGGCAAGGTT
TTCCGAGACGTCTACCACCTCAACCGGCACAAGCTGTCGC
ACTCCGGCGAGAAACCGTACGCGTGTCCGGTGTGCGGGCT
GCGCTTTAAACGCAAAGATAGGATGTCTTACCATGTGAGG
TCTCACGACGGCTCCGTGGGTAAGCCCTATGTCTGTCAAA
GCTGCGGGAAAGGTTTCTCCAGGCCAGACCATCTGAATGG
ACATATAAAACAGGTGCACACCACAGAGAGACCTCACAAG
TGTCAGATTTGCAACGCGTCCTTCGCAACACGAGATCGCC
TGAGGTCGCACCTGGCGTGTCATGAAGATAAGATACCCTG
TCAAGTGTGTGGGAAATATCTCCGGGCTGCCTACATGACT
GACCACTTGAAAAAACACAGCGAAGGACCTCATAACTACT
GTGGAATATGCAACAAAGACGGGCAGGAGAATGCTGGGAA
ATGTCCTCATCAGGATTCTGACGGTTCAGATGCAGTTTTC
GGTGACCTTTCCAACGGAATGGATCTCAAGGCTGAACATA
AAGTTGAGGGAGAAGAAATGGAGGTGACATCCTTCATCTT
CAACGGCCAACCTGATGACGCAGTGACCTCACCAGAGGGC
TCCAAAAACATCCCAACAACAGACCAGGAAAAGAAGTTCG
CCTGTGGCGAATGCGGTCAGGCTTTCCGCACAAAGTCTTA
CCTCAACAAGCACCATCACCGTGTCCATAAGAAACGTGCT
GCGGCTGCCTCCAGTCTTGGAGACCTCGCCTCACCCTTTT
CCCCCCAACAGAATATGTCACTTCTTGAATCCTTTGGCTT
TCAGATCGTCCAGTCGGCCTTTGCCTCCTCACTTGTGGAC
TCTGAGATTGGCAGCAGTGGAATGGGTTTAGGGGAGAAAT
GACCCTTTTGAGAGGCATAACCAAACTTTTATAACTGCGA
GTTTAATCTGTTGTCTCATACTCCTTGACGCCATATGTAG
ACTACTTTTGTTTTGTTCAATGTTTTTAATTAGTATGATG
TTTGTTAATGTTTTGACTTTGCCATCATGAGCTATGTTTC
CATCTAAACATAAATCTTATGCGCAGAACTGGAATATAGG
CATAAAACATTAACAAATAAAACACCGTTTCCTTCAAATG
AGTCTAAGAAGACAACAATCGTCACATTCTGATGAACTGA
ATGCAAATATTAGAAAGAAAAATGGATTTTTGAAAAATAA
ATAATTACTTGCGCCTTAGAAGCTGACACACAATGAAGGT
GAGGGGTGCAAGACCGCTTTTTGATGGACAGGGATTTTTT
TTTTTTTGATGTTTTACAATTTGCAATGTGTCAAATTGCA
CCCATTCTTATTATCGCATGATCTTTTATAACAAAATCCC
CTGACATTTTTGATGCTCATAATGGAATTTATGTAGTAAA
TGTGTCTCCATTATAGTTTATACAATTTATTTTGGGAAAA
AAACTTTTATTTCACTCAGTTATGCGCATATGTTTATGTA
CATTTTTAAAATGTATGCACATCTTGACATTTCCATCTAG
AAATTTCAATTTGATATTTCAAAATCTGCGTGAAAATGGC
TGGATGGAAACATAGCTGTTTTGATTCCATTGTGGTGTGA
AGCAGCTAATTAGTTTATTCCACATTTGACAAGTCCTCCA
CCTCTGACATGTATGTTTATTATCACGTGTGTCTGCTTCC
GGATTCATGGGTTGAGGATGATGTTTGATGTAAAAGACAA
ACCAATGCCCTAAATATGTTCCGAATGTATACCTCTAGGT
TGTTTTTGTCCAGGCAGTGTCCATGTCCACACATCGAGTA
CCTCACAGAGAACGTAACATTAAGGAGCATTTCAATTTTA
ATGCTAAAAACAAGTTTTCACCATCAGAAAACAAAGCTGG
AGTCATTAGAACTGTTTTGTAGTCCAATGACTACTGAAGC
TGTAGACTACTGATGTAAACGAAGGTCGCTTTATCTCACA
ATTCTCACTTTTCTCTCAACTGTGGGTTTATATAGCACAT
TTCAGTTTTCCCCTCATACCACAGAGAAAAAAAATCTAGG
TATATGATTAAATCACTCAGTTGCAAGTTAATAAACCTTT
CTGGGATTATATTACAATTCCATTTTTTTTTTCAAGATTA
AAGATGTAAAAAAATTAAAAGTCCAAAATTTGTAGAAATA
AAGTTCTGAGGGGAAATTAAATTTTTCCAACTTGGCTATT
GGGAGGTTTAAACTCAGAGTTTTTTTTTTAAGAAAAGATT
AATTTTAAGATCTAAACTTGCAGTTCTTGCAAAAAAAAAA
GTATGAAATCTATTTTTTTTTTTTTTGAAGATTAAAAGAT
GTTAAATGTTGAAAAGTCCAAAAATTCAAGGTATAAAGTT
CTGAGGGGAAAGGAAAGTTTTCCAGTTTGGCTTTTGTAAG
TTTAAAATTAATCATTTTTTTCTGAACATTCGAAGTTTAA
ACCTCACAATAGCCAAGTTGTAAAACTTTCTTTTTCCTCA
GAACTTTATACCTTGACTTTATAACTATGAACACACCTTT
TAATCTTGTAAAGAATTAATTCATTCTTGCAACTGCATGT
TTTCCAACTTGACTATGGTGAGGTTTAAACTCAGAATTTT
CAGAAGAAATTAATAATTTTAAGATCTAAGCTTGAAGTTC
TTGCAGAAAAAAGTTTTCTTAGTTGTACTGTTATAATTAT
ATTTGTTTTTATTTTATTTTTTATTTATTTTTTATTAAAG
ATATGTTAAAAATTTTAAAGTCCAAAAATTCAAGATATAA
ATTTATGAGGGGAAAGGAAAGTTTTCCATCTTGGCTGTTG
TGAGGTTAAAATTCAGAATTTTTTAGCAGAAATGATTAAT
TTCAAGATCTAAATTTGCAGTTCAAAGGATTAATTAATTT
TATTGTTTTTTTTTTTTTAAGATAAAAAGTTGTGTTAAGT
TGAAAAGTCCAAAAAGCCAATATATAAAGTTGTGAGGGGA
AAGCAAAGTTTTTTTCAACTTGGCTATTGTGAGGTTTACA
CTACAAATTTTCAGAAGAAATTATACATTTTAAGATCTAA
ACTTGCAGTTCTTGCTGGAAAAAAAAAATAATTCTGTAGT
TTTTTTTATGATTAAAGGATGTGTTAAATGTTGAAAAGTC
CAAATTTCTGTTGAAAATTCTGAGTTTAAGATCTAAACAT
GCTGTTCTTGCAGAAAAAGGTATGAATTAATTATATTGTT
TGTTTTTTTTTAGATTAAAAGACGTGTTATGTTGAAAAGT
CCAAATATTCAAGATATCAAGTTTAAGGGGAAGGAAAATT
TTCCAACTTGGCCGTTATGAGGTTGAAGTTTGAGAAGAAA
TGATTAATTTTAAGATCTAAACATGCAAGAAAAAAGTATG
AATTGTGAGGAAAAAAATTGAAATCATTTTCTTATTTTTG
TTACTCTGGAAAAAAACAAGCTTCCATATATGACACAAAA
CCTACATCACCTACTTCAACATTTTAGTATGAAATACTTT
CGTCAGTTATTTAAATGAAATCCTTCAAAACTTAAGGCCA
AACGATGGCTGTGATCTCAGTAATATTTTGTGCTTTGTTT
GTCTTGGATAGTACTGAAACAGATTGCTTTTGGTCACGAG
ATGTGTGTCTGTTTTTAACGTCCAACAGGGACCAAATTCA
GGTTTCACTGTAAGATATAGCAAGAAGCAAAGAATATATT
TTATTAACTTATTGATACCAGTGTCCAAGTCTCCTTTACA
AAAAGGTATATATATTGAGTTGTTGCAACATGCTTTTTTT
TTCCTTTTTAAATCATGCAGCCGACAGGAGGAGAGCGTGA
GTGTGATGACGTGTGTTTGTGTAACACGAGTGTATGCTGC
GATCTCTCTGATGTCCTTTATCTCTAGAATGTAATATAAA
CAGAGGGCTTTGTAATCTTTTCTTTTCTTAAATATACCAG
AGTTTTTCTAAGTGGTTCAATACATTCCTGCTTAACTTAA
ATTCTTGTCACTATACATGACGTATAACATTCATATATAT
ATATATATATAAAGCAAATATGTATATATGTATGGCCAAT
TATGTTAGTTTTTGTGAACGGGATCCTTGTAAATAGATAT
TTTTCTGGGCTTTGAATGAACGAATGGACGTTTTTATGCT
TTAAATACTTGTTTTAAGTGGATAATGACACATCCACACT
TTTGTTGTGTCTTGATTATTATTATGCAAGTAATTGAGTG
TGTGTTTGGTGTTAGCCTGTTCCTCTGAATGCAGTGTTAA
TGCTGGTTATATTTCCCTTTACTTTACCCTGCAGGTTATT
TGTATAGTCTCCCATCAACTTATATGTATTTGGAAGGGCA
GTTTGTCATTCATGATGGAAGCTGTCAGTGAATTTCCTTT
CTGTTAACATGTAAAATCTAAAGCAGGCTGATCTGAGCAG
TGGACTATGCCGAGTATGCTCACTTATTTGACTAATCATT
GCTAATTTAACATGTTTTAATTGAAATATTATTCTTTTAA
TAGTAACAATCATCATCTGCCTGGCATCATAGTGTGATCT
GAATATTTGCAGCCCTTATTTATTTACCAATTAAAAATGG
TTTGATTTTTTTTTCCTATTATTATTATTATTAATGTTAT
TCTATGTTTGTCTAGTAAGGTGTTCTGGCTTATTACATCA
CTGGAAACGTTTTTTTTTCTAGCTTATATATTCAATTACT
TGTATGTTGCAAAGTGCCTTCCCAGTACTGATTGTGAACA
GCGATGGGTAGGAAAAATCTGTCATTTAAAGGACCTATCT
TTAAAAAGAACCCATATACAAACAGAGTTGCATTGACACT
TTTGTATAAAGACATGCACATAGAGAAGTGTACATTTGTA
CATGTTTGGTATTCTACCTTTTTTTGTTTGTTTGTTTTCT
GACAAAATGTTGTTTCTCTGCAATTTATGTCACGGCGTTG
ATCAATTTTTGGACATTTGGATATAAGCATACTTTTCTAT
TGATGTTTGTTTTTGTACACTGTTTTTCGTGTCTCTGTCT
ATTTGGCACAGAGATGGGTATAAAATAAAACTGTATTTGA
GAATTTTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
patz1-201 Contained in:
OTHER patz1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055056 (1)
  • Ensembl_Trans:ENSDART00000156660 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA496513 (1) 862bp
    GenBank:AL913799 (1) 529bp
    CITATIONS (2)