ZFIN ID: ZDB-TSCRIPT-131113-559
Transcript Name: herc2-202
Previous Name: herc2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054817|OTTDARG00000038251|ZDB-GENE-070718-6 herc2|OTTDARP00000043003 herc2-001 LG_ FP085470.9 Danio rerio protein_coding KNOWN, 2606 bp
ACACGACATGGCCGACATTAAAGTGCAGTAAAGCTGGTGG
TAGGACCGAAGAAGCAAAGATTCAATAAGACAACCGAACA
GGGAAGGCTGCGTCTGCAGCCAGGAGAGCCGAGGGAAGGA
TGCCTTCTCCATCATTTTCCCTGAATGCCCAGCTGCGCTT
CCATGATAAATGGCTGAAGATCGACTTGCAGCGCGCCTTC
TCTCATGAAGGACTGAGCGAGATGTGGAACGAGATGGTGA
AGGATGAAGAGATCGTCTTTGACAGAGAAGAGTCTGCCCA
TCCAGAGGACTGTGCTGATTGCACCCAAAAGAAAGATGAC
ACCAATGATAAAGAAAAGAAGGAAGAGGAGGAGGCAGCAG
CAACGGCGGCTTCATCTTTCCATCACTCCATCATTGAAAT
GTGGGACTGGGGGAGGCAGCCAGAAACCAGCGAGCTGCGG
GACTGTCTGATGGCTTTGGTAGACGACCAACAGAAGCTGT
CTTCTCAGACGGCTAAGAGCACACTCTCAGCCCTGCGTCT
AAGCCAGAGACTGGTGATCCTGGAGCGCTACCTCATCTCG
CTCACTCACAGCATGATGGAGGAGAAGTACAAAGTACGGT
GGAAGAGCCCTCCCAGTCCTCCACTCTCTGCTGTCGACAA
CAAAAGCGCTCGGCCAGTTAGTAAAGGGGTGGAAGGTTTG
GCCAGGGTGGGCTCAAGGGCAGCTCTTTCCTTTGCCTTTG
CATTTCTCCGCCGAGCCTGGAGATCAGGAGATGATGCAGA
CCTGTGCAGTGAGTTACTGCAGGAGTCTCTGGATGCTCTG
CGGGCTCTTCCAGAAGCTACTCTGTTTGATGAGGGCACTG
TATCTCCTGTTTGGCTGGAGGTGGTTGAGAGGGCTACTAA
ATTTCTAAGTGACATCCATGGAAGTGCCAGTGGAAAAGCA
CCCAGTAACATTCCCTTGCAGGATCAGCACTTGGCCCTTG
CCATCCTGCTGGAGCTCGCAGTGCAACGAGGAACTCTCAG
TCAGCTGCTGTCTGCAGTTCTGCTGCTTCTGAGGCTCTGG
GACAGTGGAACTAGAGAGATGGATAATGAGCGCTCCACCC
AAGGCACCAGCGCCCCGTTACTGCCCCTCCTGCAGCGCTT
CCAGAACATCCACAGCAGTAAAGAGGAGCCTGTTCCTGAA
GAGGAGATTGAGATCCTTTCGGCCCCTCTGAGCCCGAATG
AGAGTTTTCTGCGCTACCTTACACTGCCTCAAGATAATGA
CCTGGCCATTGATTTGCGGCAGACAGCTGTAGTCATCATG
GCACATTTGGACCGCCTGGCAGCCCCATGCAGCCCCCCGC
AGTGCAGCTCACCCACTTCTAACAAGGGGACACTGCAGGA
GGTGATTGGTTGGGGTCTGCTTGGATGGAAGCCTTATGCT
AATGTGAATGGACCAATTCAGTGCAAGGCACTATCAAATC
TGGGTGTCACGCAGATTGTCTGCTCAGAGAAGGGTTTCCT
CATCCTGACCATCACTGGTGCTGTCTACACACAAAACTAC
AAAAGTACTACACTAGCACCTATGCTAGTCCATGCACTGA
CGTCCAGGAAAATAATGAAGCTTGCAGCTCATCCTGATGG
CCAGCATTATTTGGCTCTTTCAGTCAATGGAGAGGTTTTC
TCCTGGGGTTGTGGAGATGGAGGCAGGCTAGGACATGGAG
ACACTACGTATTTAGAGGAGCCCACTATGATTTCAGTATT
CTCAGGGAGGCCGGTAGGGAAGCAGGTTGTACATATTGCC
TGTGGCAGCACATACAGCGCAGCCATCACAGCAGATGGAG
AGCTTCACACATGGGGCCGAGGAAACTACGGCAGACTGGG
CCATGGCTCCAGTGAGGACCAGACCACTCCCATGCTAGTA
ACTGCACTGAAGGGGCTGAAGGTGATCGATGTGGCCTGTG
GAAGCGGAGATGCTCAGACGCTTGCTGTGACTGAGAATGG
TCAGGTATGGTCATGGGGTGATGGAGATTATGGGAAACTG
GGCCGAGGGGGCAGTGATGGATGCAAAACACCAAAACTAG
TGGAGAAGCTCCAGGATCTGGATATTGTGAAGGTGTGCTG
TGGGAGCCAGTTCTCCGTAGCGCTCACTAAAGATGGACAA
GTTTACACCTGGGGCAAAGGAGACAATCAACGACTTGGAC
ATGGCACTGATGAACATGTCCGCTATCCAAAACTACTTGA
CAGTCTGCAAGGCAAGAGGGTGGTGGACATAGCGGTTGGC
TCCACACACTGCCTGGCCCTTACAGAAGAAGGAGAGGTGC
ACAGCTGGGGCAGTAATGACAAACTACAGCACTTTGACAC
ACTTTTCTCCAATAAGAAGCAGCCCAAAGCCTTGCCAGGC
CTCAACTCCAAACACATAGTAGGCATCTCCTGCGGTCCTG
GCCAGAGTTTTTCATGGTCATCCTGCTCTGAGTGGTCTGT
GGGTCTCCGGGTACCCTTCGTGGTAGACGTGTGCACTATG
ACCTTTGACCAGCTGGACCTGCTTCTGCGCCAGGTTAGTG
AGGGCATGGACGGCAGCTCTGATTGGCCACCACCACAGGA
GAAAGAATGCATGGTCGTGGCAGCTCTCAACCTGCTCAGA
CTACAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
herc2-202 Contained in:
OTHER herc2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054817 (1)
  • Ensembl_Trans:ENSDART00000154364 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH584388 (1) 917bp
    CITATIONS (2)