ZFIN ID: ZDB-TSCRIPT-131113-4586
Transcript Name: ottdart00000059270
Previous Name: ch211-67p4.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059270 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059270|OTTDARG00000041100|ZDB-GENE-051010-1 ihha|no_translation CH211-67P4.3-001 LG_ BX942813.20 Danio rerio antisense NOVEL, 1666 bp
GGGCACAACCGCTGAGCAACAGGTTTAATGCGCTCGCAAT
CGAATCAAAGCCACTGAGTGTGTTTCTAATGGGCTGATAA
TTGAATTCATAGCAAGCGCGTTCTCCAAGTGCCGCTCACC
TGCGTCATGAGTCGATCCGCACCTGTGTTCTCCTCATCTT
TGAAGATGATGTCCGGGTTGTAGTTCGGCGTGAGCTCTTT
AAAGCGCTCTGAGTTCCTGGTGATCTTGCCCTCGATTCTC
CCGCTGGCTCCCAGTGTCTTCTCGGCTACATTTGGACTAA
ACTGCTTGTAATTAAGGGGTGTCAGTTTCTTCGGAGGCCG
CCTTTTCCCATGTCCCCTCCCCGGCCCACAGCCCTCGTTA
ACAGGTGCGAAAATCAGGGCGCAGCCGACGAGGAGCCCAA
ACACCACGGGGAGACGCATTCCACCGCAAGCGGCCGGGCA
CTCCGATGCGGAGTGGTACGGTGGCACAGCTCGCCGTTCA
CTGAGAAACTACCCCCCGCGAGATCCTTCTTCCCCCCCAC
GGGGTAAATGATGGGGAGGACAAAACCTCTACTTCTTTAT
TAGCCTTATCCGTGCCATCGTCCGTGCGTAAAATTCGCTT
TACGCAAAGCCAGTCATGGAGAGCCGCCGGAGAAAAGATC
CAGTGATACCAAATGTTCAGTGCCCATAAAACGCGAAACG
CTGGTCTCTCGAGAAAATCACCCAAATGAGAGCGAGCGGG
CAAGTCCATTTATTTATCTAACAGATTCCAGGAGAGAAAG
AGAGAGAGAGATAGACTCCGGGAGAGCTTTCAGAGAGACT
CCTGCTGTCTTTGAATGCGTGCGTCCGTCAAGTGATCTGA
GCTGCCGGCGCACTGAAGACAGACCGCACCCTGCCAGCTT
CTTGCCCCTCTCTATCCCTGCCTGCCACTCCTCCCCATGG
GTCACATTGGGTGCGTCGTGCTGTATGCCCACCGGCTCCC
TTTAACGCTTCACAGCGCCTGGCTGGGCAAACACACGTCT
CGAGGAAGAACTGGACTCAGACTCTCCCATTCATAGATCC
ACAAATAGATAAGGGGCCTGGCTGCTCCTCAAACAAACGT
GAGCGACTGCTGCCCTCCCCTACCTGCCTAACACTGATAT
GATGAAGGAAACACGGCAGACTACAACTTGCCGAAGGATT
GATTGGTTATTTATTGATCAGAAGACATCCGTTTGGGTTC
AGTTTAGGTGGCAGGTGTAAGAGTTGAGAGATGATTGATT
TATTTATTTTGTCCTGAACTCTATGCAAAGTTACAGAAGC
TAATTTGGAAATGCTGTACTTAAAGTAAACACTGTAAATG
TAAACCCATGAACATCTTTGCATAAACACTGCACTAATGA
GATATACTGTAAAGTAGTTTTATAAATGATAATTAACATT
TAAAAAAACTTTTTTGTGTAGCTTTTAAACCCATAAATGG
AGACATTTTTTTGACATGTGTTTGGTTTAATTGTTTTCAG
AGCTGACTACATTTTAACCATGTTTTTCAGACACCCATTT
GAAAAATACAGTACAATTTTGTGACTTATTTTTATTTAAG
AATCAGTACAGACCCCAAATACTAATTGCCATGTTTTAAA
ATTTATACCATATCCTTTGAACCCATTTGTCAGCAAGAAG
TTTTAATAAATTAAAATGTAGAGCAA

ihha TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ihha-201 (1) 1600
antisense ottdart00000059270 1666
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000059270 Contained in:
OTHER ottdart00000059270 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059270 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC094300 (1) 1690bp
    GenBank:EH602186 (1) 790bp
    CITATIONS (1)