header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4508
Transcript Name: wnt9a-201
Previous Name: wnt9a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058887 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058887|OTTDARG00000040826|ZDB-GENE-060825-97 wnt9a|OTTDARP00000045985 wnt9a-001 LG_none FP245476.3,FP102374.4,FP245396.14 Danio rerio protein_coding KNOWN, 1158 bp
GGATTTTACACAGCAACTCAGGACGAACGAAATGAGCTGC
CCCAGAGCCGCTACAAAATGCTGGATGGACACCTTCTCCT
GGGATGGTTATCATTTACCATTATAGTGCATCTGATCAGC
CTGCCCGGACCGAGCACGGCTTACTTCGGGCTGACAGGTA
ATGAACCCCTGTCCATTCTGCCACTGACCTCACAGCCAGA
CGAAAGGGCGGGAAAATCGCACTACAAGCTGTGTGATCGA
CTCAAACTGGAGAAGAAGCAGCGCAGAATGTGCCGACGGG
ACCCTGGCGTGGCCGAGACGCTGATGGAGGCGATCAGCAT
GAGTGCTTTAGAGTGCCAGTACCAGTTTCGCTTTGAGAGA
TGGAACTGCACGCTGGAGGGCCGATACAGGGCTAACATTT
TAAAGAGAGGCTTCAAGGAGACGGCGTTCCTCTACGCTAT
TTCTTCAGCGGGCCTCACCCACGCCATGGCCAAAGCCTGC
AGTGCTGGCCGAATGGAGCGATGTACCTGTGATGAGGCTC
CGGACCTGGAGAACCGCAAGGCTTGGCAGTGGGGAGGCTG
TGGAGACAACCTCAAATACAGCAACAAATTTGTCAAGGAC
TTCCTGGGTAAGAGGTCAAACAAGGACCTCCGTGCCCGGA
TAGACATGCACAACAGCAATGTAGGAATGAAGGTGATCAA
GACTGGGGTCGAGACCACCTGTAAGTGCCACGGCGTTTCG
GGCTCATGCACCGTGCAGACGTGCTGGAGGCAGCTGGCGC
CCTTCCACGAAATTGGCAAGCAGCTCAAACAGCGCTACGA
GACGTCGGTCAAGGTGGCCAGCTCCACCAACGAGGCCACC
GGGGAGGGCGAGATCTCCCAGAGTCGCTCCCAGAGCCAGC
AGCCCCCCCAGCCGGACATCCCCCGCACCCCAGATCTGCT
ACACATCGAGGACTCGCCCAGCTTCTGCAGGCCGAGCAAA
TATTCGGCGGGCACGTTGGCTCGTAAATGCTACAAGGACA
AGAACTGCGAGGCCATCTGCTGTGGCAGGGGACACAACAC
CCAGAGCCGGGTGGTGACCAGACCGTGCCAGTGCCAGGTG
CGCTGGTGCTGCTATGTCGAATGCAAACAGTGCACACAAA
AAGAAGAGGTTTACACCTGTAAGGGGTAAAAAAAAAAA

wnt9a TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript wnt9a-002 (1) 1045
mRNA wnt9a-201 1158
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wnt9a-201 Contained in:
OTHER wnt9a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058887 (1)
  • Ensembl_Trans:ENSDART00000130349 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:FJ231750 (1) 1151bp
    GenBank:CO958055 (1) 783bp
    CITATIONS (2)