ZFIN ID: ZDB-TSCRIPT-131113-4392
Transcript Name: pak4-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057459 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057459|OTTDARG00000040061|ZDB-GENE-040704-69 pak4|OTTDARP00000045035 pak4-001 LG_ CU856359.11 Danio rerio protein_coding KNOWN, 5449 bp
CACAGAGAGCACGAGCAGCGCGCTCATGAGGGCTTCACTC
ACTGATACGCGCACTTAGCCCGTTTAAGCTAACTTTACAG
TCTAGAAACTTCACCGACCATATGAAGTTTATTTCTCCAC
AGACGCACTTCTCACTACAGGTCTGATGCCCTGCTGCAGC
CATGTTCAGCAAGAAGAAAAAGCAACGCATCCAGATCTCA
GCACCTTCGAACTTTGAGCATCGTGTCCACACTGATTTTG
ATGAACAGGAGCAGAAGTTTGTTGGCCTTCCACGCCAATG
GCAGAGCCTCATTGAAGACACGGCCAAGAGGCCCAAACCC
TTCATCGATGCCACAGTCATCACTACTGTTGAGCCACGCA
AGACAATTGTCCGAGGTCGTAAGATCGGTGACGATGGCTC
CCTCACCTGGCTCCTGGATGAGTTTGAAACCATGTCGGTG
ATCCGCTCCAACTCCCTGCGGAGAGGCAGTCCACCTTTAC
AACCACGCAGTGACTCTGGATCATCAGGAGGCCATGAGAA
CGGCGAACACCCCCAATATAGACACACTGATCGCTATGGG
GACAGCAAAGAGAGGGAGAAACCACGTCAGGAGCACCCAG
GCACTGATCCTAGACAGTCTCAACGTCCGGGCCGTTCGTC
CAGAGAGGATGGCCGGCCTCAGCAGCAGCCTCGTGGTCAG
GAGCCCAGCAGACACAAAGAACCTGACTGGATTACACCGG
GCCAACACCGAGAACGAGAATGGGACAGAGAACGAGAACC
ACGTGATTATTCTGACCACGTAGTAAGGAGAGAGGGGGCC
AACGATAAGAGGCCCAAATCCAGCTATACTGGGAGGGATA
GCAGCCCACAGTCGCCTCGTGAGAAGAGACCACTGTCAGG
GCCAAACATCCGCACTCCTAACCTACCTGTTACAGAGGGA
GTGATAAAGGCAGCACAGCAGACTGGCCGACCTTTCAACA
CATACCCACGCTCTGAAAGTGACTCTGGGAGAACCCCCAG
CGGTCAGGATTTAAAGCCAGCTAAATCTCACGAGTCTACC
CACCACAATGGCCCCTCTGCTGGCCCAGTCCGGGGTGGCA
GTAGCAGCAGCAGCAGCGGTGGTGGTCAAACTTCTTCTCA
GGGGCCTCACAGATCAGAGCCTCAGCATCACGCCTCTCAT
CCAGCCTTGGGGCCTGAGCCTCCTCACGGCCAGCCCATGC
CTCCTCCACCAAAACCATCTGGCCCGGCTGCACCATCCCA
GCCGACACGCTCACCTCAGCGAGAGCCACAGCGGGTCTCA
CACGAGCAGTTCAGAGCTGCCCTGCAGATGGTAGTTGATC
CTGGCGACCCGCGTACTTATCTGGATCACTACATTAAGAT
CGGAGAAGGCTCCACGGGCATTGTGTGCATAGCTACTGTG
AAGACCACAGGCAAACTGGTGGCGGTGAAGAAGATGGACC
TGCGAAAACAGCAGCGACGAGAACTGCTGTTCAATGAGGT
GGTGATCATGCGGGACTATCACCATGAGAACGTGGTGGAG
ATGTACAACAGTTACTTGGTGGGGGATGAACTCTGGGTTG
TCATGGAGTTTCTGGAGGGCGGCGCTTTGACTGATATAGT
CACACATACAAGGATGAACGAGGAGCAGATCTCCACCGTG
TGTCTGTCAGTGCTAAAAGCTCTCTCAGTCCTTCACTCTC
AGGGAGTCATTCATAGAGACATCAAGAGTGACTCCATTCT
TCTCACCCATGATGGCCGTGTGAAGCTGTCAGACTTTGGT
TTTTGCGCCCAGGTCTCTAAAGAGGTGCAGCGCAGAAAGT
CTCTGGTAGGAACGCCCTACTGGATGGCCCCTGAGCTCAT
CTCAAGACTCCCATATGGACCAGAGGTGGACATTTGGTCA
TTTGGCATTATGGTCATCGAAATGGTGGATGGAGAGCCGC
CGTACTTCAACGAGCCACCGCTCAAGGCTATGAAGATGAT
CCGAGACAATTTGCCACCCAAGCTCAAAAATCTCCACAAG
GTATCGCCTCTTCTCAAGGGATTCTTGGACAGGATGCTGG
TGCGAGATCCTGCCCAGAGAGCCACAGCTCAAGAGCTGCT
AAAACATCCCTTCCTGACTAAAGCAGGCCCTCCCTCCTGC
ATTGTTCCTCTCATGAGACAAAACCGCATGAGATGAGAAG
AGAAGTCAGGGTGGATCTGACAGGCCCTCCGCTGAGCTCA
AAGACCCAGGCAAAAACATGGAGTCTGTACTGCACACTTT
AAATGATTGTACAGGTCAAGAATTTAAGGAGAACAGGCCA
TTGATGCTACAATTTTTTTTCCCTAAACAAACATTTATAC
CACTGTTTTTATTACATTAGAGGATACAGCACATGACATA
GACATGATTAGGTCCTTCACAGTGTTCTGCTGGAAGAGGT
TTTCCTCTCTGGCAAATTTAAGGAACACACAAACCATGTG
TTCTCGGTGGTTTTGCCAAGTCTGCTTTGGGGTAAACCGA
ATTAAGAAGGTTGAGACGTTATGAAAATGAACCACTTGGA
GATCCTAATCTGCCCTTAGTGTAAAGCAACCTTTTGATGG
ATTTGTTCCAAACCTCGAGCTTTCTTTTCCCTGCACTTGA
CCTTTTGCACCGTGACCACACTACTCAATAATCAGTTATT
AATAGGAAAGCAACTACTGAAGAAAACCTTTACGTTTTAT
TAAAAAGAATGCAAATCTCTAGGCTTCTGTTACGACACTA
AGCAAAGATAAACACTGGAGGCATTTCGTTTTTTAATTTT
GTTTTAATGAAAGTTGAGCTCTATATTGGTTTGTGTTTCG
AGTGACAGTGATGCTCTTAAACACTGTTCTGAGCTGCACT
CCAATATCAAACTTCCTCCTTTGACTCATTGTTCCACTTT
TTTAATATAATTAAGGGGGGAAGGGTTGGATGTAGGTTTT
TTTTTTTTCTCTCTCTCTCTTCCAGAACATTCACAACGGC
ACCACGCCATATTAGTTAAGTAGATGGAGTTGTTGTTTTC
AATGTAGGGCAGTCATTTCACGGACGCCCAAATCCTCCAG
CTAAGTAGCTTACATCTTTGAGGTATCGTGGCCTTTCTCT
GAAGGATTCATTTTGTCGGAGAGACTATACGAATGTATAG
TGTGCGTGAAGGATGCTCTACTTTGAGAGCTTGTTCAAAG
GAAGTGGACACTATAGTGAATAATTCCACACTAAAGCATT
TGTACTGAGATAATTGGTCATTTACACTATGGGTAGTGGA
ACAACCAAAGACTTGCTGACGATTTATAATAGCAGTTGCT
CCAAACATATTCCAAGTACACTACGTCTCATTGTGTTAAA
GAGATAGGTCACCCAAAAAATTAATCTTTCCTCATCATTT
ACTCAGATTCAAATGGTTCTAAACTTGGTGGTTTCTTTCT
TCTGTTGAACACAAAACAAGACGTTTTGATGAATGTCGGA
AAAAAGCAGCCATTGACATAGTAGAAACCAAAAATAGTAA
GGAAGTCAATAGCTGCTGCTTTCCAACGTTTTGTCTTCGA
CAAAAGAAACTCAAACAAGTTCAGAACTGAGTAAATTTCC
AAAACTTTACTAAACCGTATGATACAGATTGGCCGATACA
TAATGCACTCACAGATGCCAATCATCAACAACAAAAACAC
TTGGTTTTGTCAGATCAATGTGTAACCTCTGATTGACTTC
AAATGGAGTTTGCCAAGTTGTGAAAATATCTTGTAATCTG
GTGATTGGCTGTTTTGATTGAAGTCTGTCAATGCATCAGC
CTTTTAACTTGTTTTTGGACCCAATTGACTTACAGTATGG
CCAAAATAGTTAGTTATTTTGTTCACTACAAGAAAGTCAG
TCATACAAGTTTTCATATTTGGGTGAACTGTCCCTTCAAG
AGTCTCTCTTTATTTTGCTCAGCCACAATAATCCAGGATC
AAAGTGGATCGAGAACGCTGACAAAATTGATAGGAATGCA
GAAGGCAGATGAAATATTCCTATTCGATGGAGTGACTCCA
CACAAATACTAAACAAATCATTGAAAGTCAAACGAATGCA
TGTTTGGTCACATTTGCATTCAGTAATTTGAAGATGAATT
GTAGCGATTTAATCCTAGACTAAAGTGGTAGCTTATGTAT
ATATGAGTTTGTTGTTTTCTTTTGCTGAGGGCCTAAACTG
TAACACTGCAACCATAACTCTAATTGTAGATGTGAAGAAG
ATTAATGACAGTTATTGACAGACATAATTAATATAAAAAA
ATACTACTAGGGTTGGTTTGTTTGTTTGTGTTTTTTTTTT
TTTTTCCCACCAGTAAAAATTTTATGGCATGTCTTTACAT
ACTGGACTGCGCTACTTCTTCAGGACGCAAACAGAATGAC
AATCAAGCATCGGAGTGGAAGTATGCGCACTAAATGCCTA
TTCAGACATGAATAAGCAATGAAACTGAGAGAATTTTGTA
GCCTCACGTTTATCTGTGAAATATTGCTAGGATTGTAGAT
TAACATCTTCAGTGCACTGAAGCAAAATGAGGTCAACATT
CCTATAAAAACAGGAAAAAAAAGCCTTATAAGGAAAGTTG
ACCCACAAATGTAAATGTGCTGTTAATTTACTCACCCTCA
GGCCATCTGAGATTTCTTTAGTAGAACATTAAAGGTTTTA
GCTGAAGCTGTGTTCCTTGGTGATTCATAAATTGGACGAC
TACCAACACTGAGTCAAGAAAAAAAAAGACAAAACAAACA
CCTGTGTCTGCTGATGGTACATTGAGTCCTTATGAAGCAA
AACAATTAGCTTTGCGCACAGACTGATAATTTCGCTTCAT
AAGACATCAATGTCTCGTCTGTAGCCATGGGTATCTGTTT
TGTTTTGCCTGCATAGTTTTTGACTCCGGAAATGCTGGTA
GCTGTTGACTTGCATTTTATCAACGATGACCACAGTTTCT
GCTGAAAACAAATATGTGCGCTACTGAAAAATGAAAGTTG
ACTACATCTTTGAGTTAATTAATAACTAAATTTTAATTTC
TGGCTGAACTACCCTTATAATGCGTAAATATATGAACATT
ATGAGCAATAGACGTTTCACAGTACTTTTTTTATTAGGTT
TATTGACTGTTTGAAAAGCAGATACCTCCTATGACCACAA
GCCTTATTTGATTGGGTGTGTGAATGGATGATGCTTTACT
GCAAGCAGAATGCATGAGTTTGTGACTCAGTGAATGTGTT
TTGAATGGCTTCTAGAAAGGACTTCTCTATTTTCTGACTT
ACATTCCCATGGTCGGTGAAAGCACATTCTCGTGTGTGTG
TGTGTGTGTGGTCAGGTAATGATCTGCTTTTTGTGTGTTA
CGTTTCCTGTTTCATGTTGTCATTTGGTGCTCAAAAGCAG
TGCTGCGAATGCTCTGGAAGGGTACATTGTATTACGATAC
GGTTTCATCCGTTTTCTGTCACTGCATTAAAACTAATGAA
TGGCCCATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pak4-001 Contained in:
OTHER pak4-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057459 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC074067 (1) 5447bp
    GenBank:EB915778 (1) 551bp
    GenBank:AL922895 (1) 534bp
    CITATIONS (1)