header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4215
Transcript Name: prr33-201
Previous Names: prr33-001, ch211-201m7.5-001, ottdart00000056697

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056697 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056697|OTTDARG00000039495|ZDB-GENE-030131-5326 prr33|OTTDARP00000044464 CH211-201M7.5-001 LG_ BX004812.8 Danio rerio protein_coding PUTATIVE, 3251 bp
GGTGACGGTTCCCTCTACACCGTCACCACTCAGTGTGCAT
TCTGAGTAACAGACTCAGGGTTTTATTTTTGGACTGCTAT
GGAGCCCGTGCCTTCCATTTGAAGGAAGGGGGAATAGTTG
AACTCAACATGAGTCTCCCGTTCTGACAGTCTAAGCTGGG
ACAAGCAGGCAGCCGCCGGACACCCCTGAACAGCAGACAC
ACAGGGGATCCTGTCTGAAGTGTCTTCAACGGTCTTCTGT
TATCTGGTGGAGGCTGAAGATTTAATGGCTGTCAATATCG
GTAAGGCTGCCCAGGCAGGCCTGCTTTCCCAGCAGTACCC
ACCACCTTTGCTTCCCAAACCTGGAAAAGAAAATGTCCGG
CTCCAGAAACTACAAAAAAAAACAGCAAAGAAAAAAGCTG
CTGCCCAAGTCTTACAACCATCGGCGCCCTTCCGCTCAAG
CCTCTCTCCAGTAAATGAAGCAAGCCCTGACCTGGAGCAC
AGCGATCACTCAACTCCTCCTAAGACTCCAGAGACACCTT
TCTATATTAGCACGGTACACCCACGCTTCAACGTCCGACC
ACTATATCAGCATGTATCGTCTCCTTATCCTCATCACAGA
GGATTCACTTTTGGCCAGACAACAAGATTTTCGCCACAAC
CACATGTGGCTCCTGGCCACACCACATACACAGCCTCGCC
AGGAATTGACATACATATTACAGCTCCAATCACCGTTCTT
CAAATTTCACAAAGAGCAGAAGTCGGCTCAGCTCTTATGA
CACATGTAATTACCTCTAAAACTCCAAGCCCTCAGCCAAA
TGTTCCTAGAGCAGCAAAACCGTTGTTTGAAGTCCCTCAA
ATCACCAATTACACTGCTAAGTCAGTACTTTTACAAATAC
CTTATACATCAACAACAAGGAGTAAAACACCTACTGCCGA
GTTACTGAGAGGCCCAACACCAACATTTGAGGGTACAACT
TCAACACTTGAGCCGAAAGGGATTACAACACCAGTAAGAG
TAAAGACACCAACATATGACTTGATCTCAATAAGAACGCC
CATGGGGCGACCCAAGACACCCTCAGATCATGTGTCACGT
GTTAGAGTATCTGTGATTGAAATTTCACGACCAAATCCAC
TTTTATTTGCTGTATCTCCTGTGCATATGGAGGGCAGAAG
ATCCAAAACACCAACTTCAAGTGTGACTGGTCCACGTGAT
GAAATTATTAAAGTTTCAACTCAGGTTAATGGAACCAGTC
ATTCAGAAATTTATCAAAACGGGGACATAGATGCCAAATC
AGTTGAACCCTTAAAAGAAAAACTGGATAAGGCCCTTTCA
GAAAACCTGCCAAAACTTGAGTCATCTAAGCCGAAGAATC
AAATACAGGAAAGCCCAAACCTTAATGGAAATGAGCGTCC
AAAGCAGGAAACTCCAACAACACTCAACATTGAACCCACG
CAAAGTCATTTCTCTTCAGTTGAGTATCAACGACCATTAT
CTAAAGTCCCTCCGTTTGCAGGTCAAAGACCCAAAACACC
AACAGCACCTAAATCCAAACCAGCCTATTATGGATTGACA
CCTGCTGAATATGCAGCCCATGGAGGAATAAAGAGCTTCT
CGCCCAGCTTTAGCATTTCTACACCAACTGTTCAACCAAG
TGCAGAAGCAACTCACCTTCCCAAACAAGTACCAGTAGTA
CCTCAACCAGATGAAAATGTGACCACACCTAATAAAAACT
CTGAAAAACAACAAGTCCAGCCACCTCAGACTGATGTTGT
CAAACATAAAATCACTGAGGTGTCTTCACTTCTAGACATT
TCTAACACTTTGGGGGACATTCCTAAGCAACCTGTGCCAG
AGTTAAAAACAAAAAAGGCTGATGTTAAAATCCCAACTAT
TGTGGTATCTGTAGCTGACACGCCATCATCCGAAGCAAAA
GCAGTGGCAGTGAGTACTGTGACTCCGAGGGTAAGAACTC
CAACCTATGGGTCTCCCAGACTTTCCCAAATGACACCAGC
CCTTCCAACTGTGAAGGAAACTACTAAAACTGAAAGTAAG
GCTGTGGTGTTGTCTGACCAAGATGTGGACAAGCCAGCAC
TTTCAAAAGTGTCGGAAGGTAAAGTAAATGCCAAACCAAC
CAAAGAATCAGAGAAGCCAACAGAGGCAAAAATGTCTCTG
TTAGAGAGAATTAAGAAGCAGAAACTTACATCTGCTTCTT
CTGAAAAACCTCCCGAAAAGGTTGAGGTTAAAGATGTGGT
TAAGCCTTTGGCTGAACCAAAAGACCAAAAGGACATTGAA
ACAAAGGATGCTCAACCTGAGAAGGTTGACAAAGTAGACA
CAAAAGCTAGTCCCCAAGAAGAGATCAAGCCTGCAGTGGA
AAAGAAAGAGAAAGATGAAGCATCCTCTTTACCTGCAGAG
TCTCTCTTGAAGGTGATGCAGAAACCAAAAGGAATGAAGT
CAAAGCTCAGTGGCTGGTCTCGTCTTAAGAAACATATGGT
GGTTGATGTAGAGGAGCCCAAGTTTCCAGAGACAGAGCCT
GGGTCAGAGAAAGATGTCCCTGCCACCACTGATCAAAATG
AAAAGCAAATGCAAAATAAGCCTGAAGACAAGGCTAAGCT
TAGTGAGAGCCAGGACAGTAAAGACCCCCCTAGAGCAACG
AAAATGTGGGATGCTGTCCTCTTTCAAATGTTCTCAACCG
AAGAGAACATAATGCAACAAATAGAAGCAAGTAAAACCGA
GGAGCAAAAGATTATGGAGGCAGAACAAAAGACACCAAAA
GAGATTCCCACATTTGCACATCGCTTGCCTGTTCTCCTGT
ATAGCCCACGGTTTGATGCCAGACGACTGAGAGAAGCAGC
TTCACGACCAGCAACAAAGATTGCAACAGTTTTTGAAATG
GGACTTATAGGCCGCAAAAATAAAGATGAAGAACCCAAAG
ACTTTAATAGAACAGCTAAAGGCTTCAGTGGTTAAACCAC
TGACTTGACGAATAACATGAATACTTGTTGTTAGTTTTCA
ATTCATCGGTAGAGTTCTGTTTATAATCCAATCCAATTCT
TTACTTCTAGCTTACACTTTTATAACTTTATAACAGATCA
GTTGGCAAGTGAACTAAATAAACACTTTTCAAATGCACAA
TAACTAATTTGTACTATTGAAGCAATTGCCCAGTTGCCAA
TTGGCATTTAATTAGTTACTCAAAAGAATAAAAAATAAAG
CAATTTTTTTTTGAAAGTTTTAAATTAAAGACATTTTGCT
TAAGGATTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prr33-201 Contained in:
OTHER prr33-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056697 (1)
  • Ensembl_Trans:ENSDART00000156828 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC139857 (1) 4997bp
    GenBank:EH587193 (1) 948bp
    GenBank:CB352281 (1) 501bp
    GenBank:EB776116 (1) 317bp
    CITATIONS (3)